Morpholino

MO3-scube1

ID

ZDB-MRPHLNO-130404-1

Name

MO3-scube1

Previous Names

Target

Sequence

5' - AGGCTGTGAGTGAATGGGTCTCTCC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-scube1

Expressed Gene	Anatomy	Figures
fli1	vascular endothelium	Fig. 6 from Tsao et al., 2013
gata1a	erythroid lineage cell posterior lateral mesoderm	Fig. 8 from Liao et al., 2016 Fig. 6, Fig. 7 from Tsao et al., 2013
hbbe1.1	erythroid lineage cell	Fig. 5, Fig. 6 from Tsao et al., 2013
lcp1	myeloid cell	Fig. 5 from Tsao et al., 2013
mpx	granulocyte	Fig. 5 from Tsao et al., 2013
myod1	somite	Fig. 8 from Liao et al., 2016 Fig. 3, Fig. 6, Fig. 7 from Tsao et al., 2013
pax2a	lateral mesoderm	Fig. 3 from Tsao et al., 2013
shha	axial mesoderm	Fig. 3 from Tsao et al., 2013
spi1b	myeloid cell	Fig. 6, Fig. 7 from Tsao et al., 2013
tal1	hematopoietic multipotent progenitor cell posterior lateral mesoderm	Fig. 8 from Liao et al., 2016 Fig. 6 from Tsao et al., 2013

Phenotype

Phenotype resulting from MO3-scube1

Phenotype	Fish	Figures
blood cell decreased amount, abnormal	WT + MO3-scube1	Fig. 4 from Tsao et al., 2013
posterior lateral mesoderm tal1 expression decreased distribution, abnormal	WT + MO3-scube1	Fig. 8 from Liao et al., 2016
posterior lateral mesoderm gata1a expression decreased distribution, abnormal	WT + MO3-scube1	Fig. 8 from Liao et al., 2016
posterior lateral plate mesoderm morphology, abnormal	WT + MO3-scube1	Fig. 8 from Liao et al., 2016
somite morphology, abnormal	WT + MO3-scube1	Fig. 8 from Liao et al., 2016

Phenotype of all Fish created by or utilizing MO3-scube1

Phenotype	Fish	Conditions	Figures
posterior lateral mesoderm tal1 expression decreased distribution, abnormal	WT + MO3-scube1	control	Fig. 8 from Liao et al., 2016
blood cell decreased amount, abnormal	WT + MO3-scube1	standard conditions	Fig. 4 from Tsao et al., 2013
posterior lateral mesoderm gata1a expression decreased distribution, abnormal	WT + MO3-scube1	control	Fig. 8 from Liao et al., 2016
somite morphology, abnormal	WT + MO3-scube1	control	Fig. 8 from Liao et al., 2016
posterior lateral plate mesoderm morphology, abnormal	WT + MO3-scube1	control	Fig. 8 from Liao et al., 2016

Citations