Morpholino

MO2-prdm16

ID
ZDB-MRPHLNO-130225-4
Name
MO2-prdm16
Previous Names
  • splice blocking e2i2 MO (1)
Target
Sequence
5' - ACTCACACTATCACCCACCTTATCA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-prdm16
Expressed Gene Anatomy Figures
barx1 Fig. 3 with image from Ding et al., 2013
dlx2a Fig. 3 with image from Ding et al., 2013
lcp1 Fig. 6 from McKinney-Freeman et al., 2012
mpx Fig. 6 from McKinney-Freeman et al., 2012
myb Fig. 5 with image,  Fig. S3F with image from Han et al., 2016
Fig. 6 from McKinney-Freeman et al., 2012
rag1 Fig. 6 from McKinney-Freeman et al., 2012
runx1 Fig. 5 with image from Han et al., 2016
Fig. 6 from McKinney-Freeman et al., 2012
Phenotype
Phenotype resulting from MO2-prdm16
Phenotype Fish Figures
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-prdm16 Fig. 2 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-prdm16 Fig. 2 with image from Ding et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal WT + MO2-prdm16 Fig. 5 with image from Han et al., 2016
Meckel's cartilage shortened, abnormal WT + MO2-prdm16 Fig. 2 with image from Ding et al., 2013
neurocranial trabecula shortened, abnormal WT + MO2-prdm16 Fig. 2 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-prdm16 Fig. 2 with image from Ding et al., 2013
palatoquadrate cartilage decreased size, abnormal WT + MO2-prdm16 Fig. 2 with image from Ding et al., 2013
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO2-prdm16 Fig. S3F with image from Han et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO2-prdm16 Fig. 5 with image from Han et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO2-prdm16 Fig. 5 with image from Han et al., 2016
Phenotype of all Fish created by or utilizing MO2-prdm16
Phenotype Fish Conditions Figures
Meckel's cartilage shortened, abnormal WT + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
palatoquadrate cartilage decreased size, abnormal WT + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
ceratohyal cartilage increased angle to ceratohyal cartilage, abnormal WT + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
ventral wall of dorsal aorta hematopoietic stem cell myb expression decreased amount, abnormal WT + MO2-prdm16 standard conditions Fig. 5 with image from Han et al., 2016
neurocranial trabecula shortened, abnormal WT + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
hematopoietic stem cell differentiation disrupted, abnormal WT + MO2-prdm16 standard conditions Fig. 5 with image from Han et al., 2016
ventral wall of dorsal aorta myb expression decreased amount, abnormal WT + MO2-prdm16 standard conditions Fig. S3F with image from Han et al., 2016
ventral wall of dorsal aorta hematopoietic stem cell runx1 expression decreased amount, abnormal WT + MO2-prdm16 standard conditions Fig. 5 with image from Han et al., 2016
neurocranial trabecula shortened, abnormal WT + MO2-mecom + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-mecom + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-mecom + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-mecom + MO2-prdm16 standard conditions Fig. 2 with image from Ding et al., 2013
embryonic neurocranium morphogenesis disrupted, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ethmoid cartilage decreased size, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
Meckel's cartilage shortened, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 3 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranium decreased thickness, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 4 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
neurocranial trabecula shortened, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
embryonic viscerocranium morphogenesis disrupted, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 2 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
ceratobranchial 5 cartilage absent, abnormal WT + MO2-prdm16 + MO2-prdm1a standard conditions Fig. 4 with image from Ding et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.