Morpholino

MO1-cdc14aa

ID
ZDB-MRPHLNO-130116-3
Name
MO1-cdc14aa
Previous Names
  • MORPH1732 (1)
Target
Sequence
5' - TTTAGTTTGGGCAGACTCACTTTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cdc14aa
Phenotype
Phenotype resulting from MO1-cdc14aa
Phenotype of all Fish created by or utilizing MO1-cdc14aa
Phenotype Fish Conditions Figures
whole organism increased curvature, abnormal AB + MO1-cdc14aa standard conditions Fig. 2 with image from Clément et al., 2012
cilium assembly disrupted, abnormal AB + MO1-cdc14aa standard conditions Fig. 4 with image from Clément et al., 2012
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO1-cdc14aa standard conditions Fig. 4 with imageFig. 6 with image from Clément et al., 2012
heart jogging disrupted, abnormal AB + MO1-cdc14aa standard conditions Fig. 3 with imageFig. 5 with image from Clément et al., 2012
whole organism curved ventral, abnormal AB + MO1-cdc14aa standard conditions Fig. 2 with image from Clément et al., 2012
embryonic heart tube left/right pattern formation disrupted, abnormal AB + MO1-cdc14aa standard conditions Fig. 3 with imageFig. 5 with image from Clément et al., 2012
left/right pattern formation occurrence, abnormal AB + MO1-cdc14aa standard conditions Fig. 3 with image from Clément et al., 2012
posterior macula cilium length, abnormal AB + MO1-cdc14aa standard conditions Fig. S3 with image from Clément et al., 2012
Kupffer's vesicle motile cilium decreased amount, abnormal AB + MO1-cdc14aa standard conditions Fig. 4 with image from Clément et al., 2012
Kupffer's vesicle cell decreased amount, abnormal s870Tg + MO1-cdc14aa standard conditions Fig. 4 with image from Clément et al., 2012
whole organism increased curvature, abnormal cdc14bvu426Tg/vu426Tg + MO1-cdc14aa standard conditions Fig. 2 with image from Clément et al., 2012
embryonic heart tube left/right pattern formation disrupted, abnormal cdc14bvu426Tg/vu426Tg + MO1-cdc14aa standard conditions Fig. 5 with image from Clément et al., 2012
heart jogging disrupted, abnormal cdc14bvu426Tg/vu426Tg + MO1-cdc14aa standard conditions Fig. 5 with image from Clément et al., 2012
Kupffer's vesicle motile cilium decreased length, abnormal AB + MO1-cdc14aa + MO1-cdc14b standard conditions Fig. 5 with image from Clément et al., 2012
cilium assembly disrupted, abnormal AB + MO1-cdc14aa + MO1-cdc14b standard conditions Fig. 5 with image from Clément et al., 2012
Citations