Morpholino

MO1-med23

ID
ZDB-MRPHLNO-121128-1
Name
MO1-med23
Previous Names
None
Target
Sequence
5' - CATCCTCAGGGCTGTCCATGAACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-med23
Expressed Gene Anatomy Figures
acta2 Fig. 7 from Yin et al., 2012
dct Fig. 2 with image from Xia et al., 2017
egr2b Fig. 7 from Zhu et al., 2015
elavl3 Fig. 7 from Zhu et al., 2015
med23 Fig. 7 from Zhu et al., 2015
Fig. 7 from Yin et al., 2012
mitfa Fig. 2 with image from Xia et al., 2017
myh11a Fig. 7 from Yin et al., 2012
myl9b Fig. 7 from Yin et al., 2012
tagln Fig. 7 from Yin et al., 2012
Phenotype
Phenotype resulting from MO1-med23
Phenotype Fish Figures
brain YC2 expression decreased amount, abnormal cf2Tg + MO1-med23 Fig. 7 from Zhu et al., 2015
brain YC2 expression increased amount, abnormal cf2Tg + MO1-med23 Fig. 7 from Zhu et al., 2015
cardiovascular system hypertrophic, abnormal zn1Tg + MO1-med23 Fig. 7 from Yin et al., 2012
heart decreased functionality, abnormal WT + MO1-med23 Fig. 7 from Yin et al., 2012
heart contraction decreased frequency, abnormal WT + MO1-med23 Fig. 7 from Yin et al., 2012
hindbrain egr2b expression increased amount, abnormal cf2Tg + MO1-med23 Fig. 7 from Zhu et al., 2015
hindbrain elavl3 expression increased amount, abnormal cf2Tg + MO1-med23 Fig. 7 from Zhu et al., 2015
melanocyte decreased amount, abnormal WT + MO1-med23 Fig. 2 with image from Xia et al., 2017
melanocyte decreased size, abnormal WT + MO1-med23 Fig. 2 with image from Xia et al., 2017
negative regulation of neurogenesis decreased occurrence, abnormal cf2Tg + MO1-med23 Fig. 7 from Zhu et al., 2015
pericardium edematous, abnormal WT + MO1-med23 Fig. 7 from Yin et al., 2012
post-vent region curved ventral, abnormal WT + MO1-med23 Fig. 7 from Yin et al., 2012
whole organism dead, abnormal WT + MO1-med23 Fig. S5 from Zhu et al., 2015
whole organism dct expression decreased amount, abnormal WT + MO1-med23 Fig. 2 with image from Xia et al., 2017
whole organism med23 expression decreased amount, abnormal WT + MO1-med23 Fig. 7 from Zhu et al., 2015
whole organism mitfa expression decreased amount, abnormal WT + MO1-med23 Fig. 2 with image from Xia et al., 2017
whole organism decreased length, abnormal WT + MO1-med23 Fig. 7 from Yin et al., 2012
whole organism decreased pigmentation, abnormal WT + MO1-med23 Fig. 2 with image from Xia et al., 2017
whole organism viability, abnormal WT + MO1-med23 Fig. S5 from Zhu et al., 2015
whole organism Melanin decreased amount, abnormal WT + MO1-med23 Fig. 2 with image from Xia et al., 2017
Phenotype of all Fish created by or utilizing MO1-med23
Phenotype Fish Conditions Figures
post-vent region curved ventral, abnormal WT + MO1-med23 standard conditions Fig. 7 from Yin et al., 2012
whole organism Melanin decreased amount, abnormal WT + MO1-med23 standard conditions Fig. 2 with image from Xia et al., 2017
melanocyte decreased amount, abnormal WT + MO1-med23 standard conditions Fig. 2 with image from Xia et al., 2017
whole organism mitfa expression decreased amount, abnormal WT + MO1-med23 standard conditions Fig. 2 with image from Xia et al., 2017
heart decreased functionality, abnormal WT + MO1-med23 standard conditions Fig. 7 from Yin et al., 2012
whole organism decreased length, abnormal WT + MO1-med23 standard conditions Fig. 7 from Yin et al., 2012
whole organism viability, abnormal WT + MO1-med23 standard conditions Fig. S5 from Zhu et al., 2015
whole organism decreased pigmentation, abnormal WT + MO1-med23 standard conditions Fig. 2 with image from Xia et al., 2017
heart contraction decreased frequency, abnormal WT + MO1-med23 standard conditions Fig. 7 from Yin et al., 2012
whole organism dct expression decreased amount, abnormal WT + MO1-med23 standard conditions Fig. 2 with image from Xia et al., 2017
whole organism dead, abnormal WT + MO1-med23 standard conditions Fig. S5 from Zhu et al., 2015
whole organism med23 expression decreased amount, abnormal WT + MO1-med23 standard conditions Fig. 7 from Zhu et al., 2015
melanocyte decreased size, abnormal WT + MO1-med23 standard conditions Fig. 2 with image from Xia et al., 2017
pericardium edematous, abnormal WT + MO1-med23 standard conditions Fig. 7 from Yin et al., 2012
brain YC2 expression increased amount, abnormal cf2Tg + MO1-med23 standard conditions Fig. 7 from Zhu et al., 2015
hindbrain egr2b expression increased amount, abnormal cf2Tg + MO1-med23 standard conditions Fig. 7 from Zhu et al., 2015
negative regulation of neurogenesis decreased occurrence, abnormal cf2Tg + MO1-med23 standard conditions Fig. 7 from Zhu et al., 2015
hindbrain elavl3 expression increased amount, abnormal cf2Tg + MO1-med23 standard conditions Fig. 7 from Zhu et al., 2015
brain YC2 expression decreased amount, abnormal cf2Tg + MO1-med23 standard conditions Fig. 7 from Zhu et al., 2015
cardiovascular system hypertrophic, abnormal zn1Tg + MO1-med23 standard conditions Fig. 7 from Yin et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.