Morpholino

MO2-mef2cb

ID
ZDB-MRPHLNO-121031-1
Name
MO2-mef2cb
Previous Names
  • Mef2cb ATG MO (1)
Target
Sequence
5' - TGTCCCCGTCTTTTCGTCTCTCTCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-mef2cb
Expressed Gene Anatomy Figures
bmp4 Fig. 3 with image,  Fig. S9 with image from Hinits et al., 2012
elna Fig. S9 with image from Hinits et al., 2012
myh7 Fig. 2 with image,  Fig. 3 with image,  Fig. S5 with image from Hinits et al., 2012
myl7 Fig. 2 with image,  Fig. 3 with image,  Fig. S9 with image from Hinits et al., 2012
smyd1b Fig. 2 with image from Hinits et al., 2012
Phenotype
Phenotype resulting from MO2-mef2cb
Phenotype Fish Figures
atrioventricular canal aplastic, abnormal WT + MO2-mef2cb Fig. S9 with image from Hinits et al., 2012
bulbus arteriosus aplastic, abnormal twu26Tg + MO2-mef2cb Fig. S9 with image from Hinits et al., 2012
heart linear, abnormal WT + MO2-mef2cb Fig. S9 with image from Hinits et al., 2012
heart formation disrupted, abnormal WT + MO2-mef2cb Fig. S9 with image from Hinits et al., 2012
heart looping arrested, abnormal WT + MO2-mef2cb Fig. S9 with image from Hinits et al., 2012
heart tube shortened, abnormal WT + MO2-mef2cb Fig. 3 with image from Hinits et al., 2012
presumptive atrium heart tube decreased volume, abnormal WT + MO2-mef2cb Fig. 3 with image from Hinits et al., 2012
presumptive cardiac ventricle heart tube decreased volume, abnormal WT + MO2-mef2cb Fig. 3 with image from Hinits et al., 2012
Phenotype of all Fish created by or utilizing MO2-mef2cb
Phenotype Fish Conditions Figures
heart tube shortened, abnormal WT + MO2-mef2cb standard conditions Fig. 3 with image from Hinits et al., 2012
presumptive cardiac ventricle heart tube decreased volume, abnormal WT + MO2-mef2cb standard conditions Fig. 3 with image from Hinits et al., 2012
heart looping arrested, abnormal WT + MO2-mef2cb standard conditions Fig. S9 with image from Hinits et al., 2012
presumptive atrium heart tube decreased volume, abnormal WT + MO2-mef2cb standard conditions Fig. 3 with image from Hinits et al., 2012
heart formation disrupted, abnormal WT + MO2-mef2cb standard conditions Fig. S9 with image from Hinits et al., 2012
atrioventricular canal aplastic, abnormal WT + MO2-mef2cb standard conditions Fig. S9 with image from Hinits et al., 2012
heart linear, abnormal WT + MO2-mef2cb standard conditions Fig. S9 with image from Hinits et al., 2012
bulbus arteriosus aplastic, abnormal twu26Tg + MO2-mef2cb standard conditions Fig. S9 with image from Hinits et al., 2012
cardiac muscle cell undifferentiated, abnormal mef2cab1086/b1086 + MO2-mef2cb standard conditions Fig. 2 with image from Hinits et al., 2012
cardiac muscle cell differentiation arrested, abnormal mef2cab1086/b1086 + MO2-mef2cb standard conditions Fig. 2 with image from Hinits et al., 2012
heart aplastic, abnormal mef2catn213/tn213 + MO2-mef2cb standard conditions Fig. S5 with image from Hinits et al., 2012
heart tube aplastic, abnormal mef2catn213/tn213 + MO2-mef2cb standard conditions Fig. 3 with image from Hinits et al., 2012
heart formation arrested, abnormal mef2catn213/tn213 + MO2-mef2cb standard conditions Fig. S5 with image from Hinits et al., 2012
cardiac muscle cell differentiation arrested, abnormal mef2catn213/tn213 + MO2-mef2cb standard conditions Fig. 3 with image,  Fig. S5 with image from Hinits et al., 2012
heart aplastic, abnormal WT + MO1-mef2ca + MO2-mef2cb standard conditions Fig. S5 with image from Hinits et al., 2012
heart formation arrested, abnormal WT + MO1-mef2ca + MO2-mef2cb standard conditions Fig. S5 with image from Hinits et al., 2012
cardiac muscle cell differentiation arrested, abnormal WT + MO1-mef2ca + MO2-mef2cb standard conditions Fig. S5 with image from Hinits et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.