Morpholino

MO2-dpysl3

ID
ZDB-MRPHLNO-121029-3
Name
MO2-dpysl3
Previous Names
None
Target
Sequence
5' - ATAAATGCACGGACTTACAGTGATC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dpysl3
No data available
Phenotype
Phenotype resulting from MO2-dpysl3
Phenotype Fish Figures
anterior commissure axon decreased distribution, abnormal RW + MO2-dpysl3 Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
postoptic commissure axon decreased distribution, abnormal RW + MO2-dpysl3 Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
Phenotype of all Fish created by or utilizing MO2-dpysl3
Phenotype Fish Conditions Figures
anterior commissure axon decreased distribution, abnormal RW + MO2-dpysl3 control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
postoptic commissure axon decreased distribution, abnormal RW + MO2-dpysl3 control Fig. 1,  Fig. 2,  Fig. 5,  Fig. 6 from Guo et al., 2022
anterior commissure axon spatial pattern, exacerbated dpysl2bwa21/wa21 + MO2-dpysl3 (RW) standard conditions Fig. 5 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal dpysl2bwa21/wa21 + MO2-dpysl3 (RW) control Fig. 5 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal dpysl2bwa21/wa21 + MO2-dpysl3 (RW) control Fig. 5 from Guo et al., 2022
postoptic commissure axon spatial pattern, exacerbated dpysl2bwa21/wa21 + MO2-dpysl3 (RW) standard conditions Fig. 5 from Guo et al., 2022
anterior commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
postoptic commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO2-nrp1a control Fig. 6 from Guo et al., 2022
anterior commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
anterior commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
postoptic commissure axon ab1-tuba labeling spatial pattern, abnormal RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
postoptic commissure axon spatial pattern, exacerbated RW + MO2-dpysl3 + MO3-dpysl2b control Fig. 5 from Guo et al., 2022
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.