Morpholino

MO4-ntn1a

ID
ZDB-MRPHLNO-120604-2
Name
MO4-ntn1a
Previous Names
None
Target
Sequence
5' - CCAAAGCATCAGAGACTCTCAACAT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-ntn1a
No data available
Phenotype
Phenotype resulting from MO4-ntn1a
Phenotype Fish Figures
anterior commissure axon extension process quality, abnormal b1204Tg + MO4-ntn1a Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO4-ntn1a Fig. 7 from Zhang et al., 2012
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a Fig. S6 from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a Fig. S6 from Tu et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO4-ntn1a Fig. 6 with image from Tu et al., 2015
vasculature development disrupted, abnormal la116Tg + MO4-ntn1a Fig. 6 with image from Tu et al., 2015
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO4-ntn1a Fig. 6 with image from Tu et al., 2015
Phenotype of all Fish created by or utilizing MO4-ntn1a
Phenotype Fish Conditions Figures
anterior commissure axon extension process quality, abnormal b1204Tg + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
vasculature development disrupted, abnormal la116Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
whole organism lacks all parts of type parachordal vessel, abnormal la116Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell migration decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. S6 from Tu et al., 2015
intersegmental vessel endothelial cell decreased amount, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. 6 with image from Tu et al., 2015
blood vessel endothelial cell proliferation involved in sprouting angiogenesis decreased process quality, abnormal is5Tg; y7Tg + MO4-ntn1a standard conditions Fig. S6 from Tu et al., 2015
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised dorsally, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster neuron projection physical object quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-dcc + MO1-ntn1b + MO4-ntn1a standard conditions Fig. 5 with image from Gao et al., 2012
anterior commissure morphogenesis process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection misrouted, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster neuron projection mislocalised, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
dorso-rostral cluster axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
supraoptic tract axon extension process quality, abnormal b1204Tg + MO1-ntn1b + MO4-ntn1a + MO5-robo2 standard conditions Fig. 7 from Zhang et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.