Morpholino

MO1-wnt3

ID
ZDB-MRPHLNO-120601-2
Name
MO1-wnt3
Previous Names
None
Target
Sequence
5' - GATCTCTTACCATTCGTCCTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-wnt3
Expressed Gene Anatomy Figures
irx1b Fig. 3 with image from Mattes et al., 2012
otx2b Fig. 3 with image from Mattes et al., 2012
shha Fig. 3 with image from Mattes et al., 2012
Phenotype
Phenotype resulting from MO1-wnt3
Phenotype Fish Figures
cloaca increased width, abnormal ki2Tg + MO1-wnt3 Fig. 2 from Baranowska Körberg et al., 2015
cloaca cell disconnected, abnormal ki2Tg + MO1-wnt3 Fig. 2 from Baranowska Körberg et al., 2015
cloaca epithelium disorganized, abnormal ki2Tg + MO1-wnt3 Fig. 2 from Baranowska Körberg et al., 2015
cloaca development disrupted, abnormal ki2Tg + MO1-wnt3 Fig. 2 from Baranowska Körberg et al., 2015
cloacal chamber distended, abnormal ki2Tg + MO1-wnt3 Fig. 2 from Baranowska Körberg et al., 2015
posterior intestine distended, abnormal ki2Tg + MO1-wnt3 Fig. 2 from Baranowska Körberg et al., 2015
pronephros distal region disorganized, abnormal ki2Tg + MO1-wnt3 Fig. 2 from Baranowska Körberg et al., 2015
Phenotype of all Fish created by or utilizing MO1-wnt3
Phenotype Fish Conditions Figures
cloaca epithelium disorganized, abnormal ki2Tg + MO1-wnt3 standard conditions Fig. 2 from Baranowska Körberg et al., 2015
pronephros distal region disorganized, abnormal ki2Tg + MO1-wnt3 standard conditions Fig. 2 from Baranowska Körberg et al., 2015
cloaca increased width, abnormal ki2Tg + MO1-wnt3 standard conditions Fig. 2 from Baranowska Körberg et al., 2015
cloacal chamber distended, abnormal ki2Tg + MO1-wnt3 standard conditions Fig. 2 from Baranowska Körberg et al., 2015
cloaca development disrupted, abnormal ki2Tg + MO1-wnt3 standard conditions Fig. 2 from Baranowska Körberg et al., 2015
cloaca cell disconnected, abnormal ki2Tg + MO1-wnt3 standard conditions Fig. 2 from Baranowska Körberg et al., 2015
posterior intestine distended, abnormal ki2Tg + MO1-wnt3 standard conditions Fig. 2 from Baranowska Körberg et al., 2015
thalamus development process quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
brain malformed, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 3 with image from Mattes et al., 2012
otic vesicle decreased size, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 3 with image from Mattes et al., 2012
mid diencephalic organizer decreased thickness, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
thalamus development decreased process quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image,  Fig. 6 with image from Mattes et al., 2012
ventral thalamus in contact with dorsal thalamus, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 6 with image from Mattes et al., 2012
midbrain hindbrain boundary cellular quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
mid diencephalic organizer cellular quality, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
post-vent region kinked, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 3 with image from Mattes et al., 2012
canonical Wnt signaling pathway decreased occurrence, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image,  Fig. 6 with image from Mattes et al., 2012
diencephalon lacks all parts of type mid diencephalic organizer, abnormal WT + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 6 with image from Mattes et al., 2012
mid diencephalic organizer increased thickness, abnormal WT + MO1-fezf2 + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
ventral thalamus decreased thickness, abnormal WT + MO1-fezf2 + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
thalamus development process quality, abnormal WT + MO1-fezf2 + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
mid diencephalic organizer increased thickness, abnormal WT + MO1-irx1b + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
dorsal thalamus decreased thickness, abnormal WT + MO1-irx1b + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
thalamus development process quality, abnormal WT + MO1-irx1b + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 8 with image from Mattes et al., 2012
mid diencephalic organizer apoptotic, abnormal ka300Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 7 with image from Mattes et al., 2012
mid diencephalic organizer decreased size, abnormal ka300Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 7 with image from Mattes et al., 2012
canonical Wnt signaling pathway decreased occurrence, abnormal ka300Tg; vu17Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
mid diencephalic organizer cellular quality, abnormal ka300Tg; vu17Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
thalamus development decreased process quality, abnormal ka300Tg; vu17Tg + MO1-wnt3 + MO2-wnt3a standard conditions Fig. 4 with image from Mattes et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.