Morpholino

MO1-fmnl3

ID

ZDB-MRPHLNO-120503-2

Name

MO1-fmnl3

Previous Names

None

Target

fmnl3 (1)

Sequence

5' - CGTCCACACTCTCAATATTCCCCAT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-fmnl3

No data available

Phenotype

Phenotype resulting from MO1-fmnl3

Phenotype	Fish	Figures
caudal vein plexus decreased width, abnormal	y1Tg + MO1-fmnl3	Fig. 5 , Fig. 7 , Fig. S7 from Wakayama et al., 2015
caudal vein plexus malformed, abnormal	y1Tg + MO1-fmnl3	Fig. 5 , Fig. 7 , Fig. S5 , Fig. S7 from Wakayama et al., 2015
caudal vein plexus angiogenic sprout decreased amount, abnormal	ncv1Tg; ncv6Tg + MO1-fmnl3	Fig. 5 from Wakayama et al., 2015
caudal vein plexus blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell filopodium, abnormal	ncv1Tg; ncv6Tg + MO1-fmnl3	Fig. 5 from Wakayama et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal	ncv1Tg; ncv6Tg + MO1-fmnl3	Fig. 5 from Wakayama et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO1-fmnl3	Fig. 5 from Hetheridge et al., 2012
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-fmnl3	Fig. 5 from Hetheridge et al., 2012
intersegmental vessel decreased length, abnormal	y1Tg + MO1-fmnl3	Fig. 5 from Hetheridge et al., 2012
intersegmental vessel disorganized, abnormal	y1Tg + MO1-fmnl3	Fig. 5 from Hetheridge et al., 2012
sprouting angiogenesis disrupted, abnormal	y1Tg + MO1-fmnl3	Fig. 5 from Hetheridge et al., 2012

Phenotype of all Fish created by or utilizing MO1-fmnl3

Phenotype	Fish	Conditions	Figures
caudal vein plexus malformed, abnormal	y1Tg + MO1-fmnl3	standard conditions	Fig. 5 , Fig. 7 , Fig. S5 , Fig. S7 from Wakayama et al., 2015
intersegmental vessel decreased amount, abnormal	y1Tg + MO1-fmnl3	standard conditions	Fig. 5 from Hetheridge et al., 2012
sprouting angiogenesis disrupted, abnormal	y1Tg + MO1-fmnl3	standard conditions	Fig. 5 from Hetheridge et al., 2012
intersegmental vessel disorganized, abnormal	y1Tg + MO1-fmnl3	standard conditions	Fig. 5 from Hetheridge et al., 2012
intersegmental vessel decreased length, abnormal	y1Tg + MO1-fmnl3	standard conditions	Fig. 5 from Hetheridge et al., 2012
caudal vein plexus decreased width, abnormal	y1Tg + MO1-fmnl3	standard conditions	Fig. 5 , Fig. 7 , Fig. S7 from Wakayama et al., 2015
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO1-fmnl3	standard conditions	Fig. 5 from Hetheridge et al., 2012
caudal vein plexus angiogenic sprout decreased amount, abnormal	ncv1Tg; ncv6Tg + MO1-fmnl3	standard conditions	Fig. 5 from Wakayama et al., 2015
caudal vein plexus sprouting angiogenesis process quality, abnormal	ncv1Tg; ncv6Tg + MO1-fmnl3	standard conditions	Fig. 5 from Wakayama et al., 2015
caudal vein plexus blood vessel endothelial cell has fewer parts of type blood vessel endothelial cell filopodium, abnormal	ncv1Tg; ncv6Tg + MO1-fmnl3	standard conditions	Fig. 5 from Wakayama et al., 2015
caudal vein plexus decreased width, abnormal	y1Tg + MO1-arhgef9b + MO1-fmnl3	standard conditions	Fig. S6 from Wakayama et al., 2015
caudal vein plexus malformed, abnormal	y1Tg + MO1-arhgef9b + MO1-fmnl3	standard conditions	Fig. S6 from Wakayama et al., 2015
caudal vein plexus malformed, abnormal	y1Tg + MO1-fmnl3 + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. S6 from Wakayama et al., 2015
caudal vein plexus decreased width, abnormal	y1Tg + MO1-fmnl3 + MO3-bmpr2a + MO3-bmpr2b	standard conditions	Fig. S6 from Wakayama et al., 2015

Citations