Morpholino

MO7-cep290

ID

ZDB-MRPHLNO-120426-4

Name

MO7-cep290

Previous Names

None

Target

cep290 (1)

Sequence

5' - TTGATGTGTACCAGTTGTGCTGATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Splice-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO7-cep290

Expressed Gene	Anatomy	Figures
arl3b	whole organism	Fig. 5. from Cardenas-Rodriguez et al., 2021
arl13b	whole organism	Fig. 5. from Cardenas-Rodriguez et al., 2021
cep290	(not) Kupffer's vesicle ciliary base (not) peripheral olfactory organ cilium (not) pronephros cilium (not) retinal inner plexiform layer (not) retinal outer plexiform layer (not) whole organism	Fig. 1. , Fig. 2. from Cardenas-Rodriguez et al., 2021
unc119a2	whole organism	Fig. 5. from Cardenas-Rodriguez et al., 2021

Phenotype

Phenotype resulting from MO7-cep290

Phenotype	Fish	Figures
axis curved, abnormal	AB/TU + MO7-cep290	Fig. 1. from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal	AB/TU + MO7-cep290	Fig. 7. , Fig. S1 from Cardenas-Rodriguez et al., 2021
central canal cilium decreased length, abnormal	AB/TU + MO7-cep290	Fig. S1 from Cardenas-Rodriguez et al., 2021
heart determination of heart left/right asymmetry process quality, abnormal	AB/TU + MO7-cep290	Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal	AB/TU + MO7-cep290	Fig. S1 from Cardenas-Rodriguez et al., 2021
Kupffer's vesicle decreased size, abnormal	WT + MO7-cep290	Fig. 3 from Baye et al., 2011
Kupffer's vesicle ciliary base cep290 expression absent, abnormal	AB/TU + MO7-cep290	Fig. 2. from Cardenas-Rodriguez et al., 2021
Kupffer's vesicle cilium decreased length, abnormal	AB/TU + MO7-cep290	Fig. 2. , Fig. 7. from Cardenas-Rodriguez et al., 2021
otolith amount, abnormal	AB/TU + MO7-cep290	Fig. S1 from Cardenas-Rodriguez et al., 2021
peripheral olfactory organ cilium cep290 expression absent, abnormal	AB/TU + MO7-cep290	Fig. 2. from Cardenas-Rodriguez et al., 2021
photoreceptor outer segment layer decreased amount, abnormal	AB/TU + MO7-cep290	Fig. 3. from Cardenas-Rodriguez et al., 2021
photoreceptor outer segment layer decreased length, abnormal	AB/TU + MO7-cep290	Fig. 3. , Fig. 7. from Cardenas-Rodriguez et al., 2021
photoreceptor outer segment layer disorganized, abnormal	WT + MO7-cep290	Fig. 4 from Baye et al., 2011
post-vent region curved, abnormal	AB/TU + MO7-cep290	Fig. 1. from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal	AB/TU + MO7-cep290	Fig. 7. , Fig. S1 from Cardenas-Rodriguez et al., 2021
pronephros cilium cep290 expression absent, abnormal	AB/TU + MO7-cep290	Fig. 2. from Cardenas-Rodriguez et al., 2021
retina layer formation disrupted, abnormal	AB/TU + MO7-cep290	Fig. 2. from Cardenas-Rodriguez et al., 2021
retinal inner plexiform layer cep290 expression absent, abnormal	AB/TU + MO7-cep290	Fig. 2. from Cardenas-Rodriguez et al., 2021
retinal outer plexiform layer cep290 expression absent, abnormal	AB/TU + MO7-cep290	Fig. 2. from Cardenas-Rodriguez et al., 2021
visual behavior disrupted, abnormal	WT + MO7-cep290	Fig. 4, Fig. 6 from Baye et al., 2011
whole organism cep290 expression absent, abnormal	AB/TU + MO7-cep290	Fig. 1. from Cardenas-Rodriguez et al., 2021
whole organism curved ventral, abnormal	WT + MO7-cep290	Fig. 2 from Baye et al., 2011

Phenotype of all Fish created by or utilizing MO7-cep290

Phenotype	Fish	Conditions	Figures
otolith amount, abnormal	AB/TU + MO7-cep290	control	Fig. S1 from Cardenas-Rodriguez et al., 2021
whole organism cep290 expression absent, abnormal	AB/TU + MO7-cep290	control	Fig. 1. from Cardenas-Rodriguez et al., 2021
axis curved, abnormal	AB/TU + MO7-cep290	control	Fig. 1. from Cardenas-Rodriguez et al., 2021
photoreceptor outer segment layer decreased length, abnormal	AB/TU + MO7-cep290	control	Fig. 3. , Fig. 7. from Cardenas-Rodriguez et al., 2021
retina layer formation disrupted, abnormal	AB/TU + MO7-cep290	control	Fig. 2. from Cardenas-Rodriguez et al., 2021
post-vent region curved, abnormal	AB/TU + MO7-cep290	control	Fig. 1. from Cardenas-Rodriguez et al., 2021
retinal outer plexiform layer cep290 expression absent, abnormal	AB/TU + MO7-cep290	control	Fig. 2. from Cardenas-Rodriguez et al., 2021
retinal inner plexiform layer cep290 expression absent, abnormal	AB/TU + MO7-cep290	control	Fig. 2. from Cardenas-Rodriguez et al., 2021
central canal cilium decreased length, abnormal	AB/TU + MO7-cep290	control	Fig. S1 from Cardenas-Rodriguez et al., 2021
photoreceptor outer segment layer decreased amount, abnormal	AB/TU + MO7-cep290	control	Fig. 3. from Cardenas-Rodriguez et al., 2021
peripheral olfactory organ cilium cep290 expression absent, abnormal	AB/TU + MO7-cep290	control	Fig. 2. from Cardenas-Rodriguez et al., 2021
Kupffer's vesicle cilium decreased length, abnormal	AB/TU + MO7-cep290	control	Fig. 2. , Fig. 7. from Cardenas-Rodriguez et al., 2021
Kupffer's vesicle ciliary base cep290 expression absent, abnormal	AB/TU + MO7-cep290	control	Fig. 2. from Cardenas-Rodriguez et al., 2021
post-vent region curved ventral, abnormal	AB/TU + MO7-cep290	control	Fig. 7. , Fig. S1 from Cardenas-Rodriguez et al., 2021
pronephros cilium cep290 expression absent, abnormal	AB/TU + MO7-cep290	control	Fig. 2. from Cardenas-Rodriguez et al., 2021
heart determination of heart left/right asymmetry process quality, abnormal	AB/TU + MO7-cep290	control	Fig. S1 from Cardenas-Rodriguez et al., 2021
axis curved ventral, abnormal	AB/TU + MO7-cep290	control	Fig. 7. , Fig. S1 from Cardenas-Rodriguez et al., 2021
kidney cystic, abnormal	AB/TU + MO7-cep290	control	Fig. S1 from Cardenas-Rodriguez et al., 2021
whole organism curved ventral, abnormal	WT + MO7-cep290	standard conditions	Fig. 2 from Baye et al., 2011
Kupffer's vesicle decreased size, abnormal	WT + MO7-cep290	standard conditions	Fig. 3 from Baye et al., 2011
visual behavior disrupted, abnormal	WT + MO7-cep290	standard conditions	Fig. 4, Fig. 6 from Baye et al., 2011
melanosome transport decreased rate, abnormal	WT + MO7-cep290	chemical treatment: (R)-adrenaline	Fig. 3 from Baye et al., 2011
photoreceptor outer segment layer disorganized, abnormal	WT + MO7-cep290	standard conditions	Fig. 4 from Baye et al., 2011

Citations