Morpholino

MO1-bhmt

ID

ZDB-MRPHLNO-120111-5

Name

MO1-bhmt

Previous Names

Target

Sequence

5' - ATGTTGATCTGATTCAGGAACAGCA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-bhmt

Expressed Gene	Anatomy	Figures
fabp2	intestine	Fig. 2 from Yang et al., 2011
fabp10a	liver	Fig. 2 from Yang et al., 2011
foxa1	head liver pharynx	Fig. 2 from Yang et al., 2011
gata6	liver	Fig. 2 from Yang et al., 2011
ins	endocrine pancreas posterior pancreatic bud	Fig. 3 from Yang et al., 2011
prox1a	liver pancreatic bud	Fig. 2 from Yang et al., 2011
prss1	exocrine pancreas	Fig. 2 from Yang et al., 2011
shha	brain gut (not) liver notochord (not) pancreatic bud presumptive swim bladder swim bladder swim bladder bud whole organism	Fig. 6 from Yang et al., 2011

Phenotype

Phenotype resulting from MO1-bhmt

Phenotype	Fish	Figures
endocrine pancreas increased size, abnormal	AB + MO1-bhmt	Fig. 3 from Yang et al., 2011
exocrine pancreas decreased size, abnormal	WT + MO1-bhmt	Fig. 2 from Yang et al., 2011
eye decreased size, abnormal	AB + MO1-bhmt	Fig. S5 from Yang et al., 2011
head decreased size, abnormal	AB + MO1-bhmt	Fig. S5 from Yang et al., 2011
intestine decreased size, abnormal	WT + MO1-bhmt	Fig. 2 from Yang et al., 2011
liver decreased size, abnormal	WT + MO1-bhmt	Fig. 2 from Yang et al., 2011
notochord increased size, abnormal	AB + MO1-bhmt	Fig. 6 from Yang et al., 2011
pancreatic B cell increased amount, abnormal	zf5Tg + MO1-bhmt	Fig. 4 from Yang et al., 2011
trunk decreased thickness, abnormal	AB + MO1-bhmt	Fig. S5 from Yang et al., 2011

Phenotype of all Fish created by or utilizing MO1-bhmt

Phenotype	Fish	Conditions	Figures
head decreased size, abnormal	AB + MO1-bhmt	standard conditions	Fig. S5 from Yang et al., 2011
endocrine pancreas increased size, abnormal	AB + MO1-bhmt	standard conditions	Fig. 3 from Yang et al., 2011
notochord increased size, abnormal	AB + MO1-bhmt	standard conditions	Fig. 6 from Yang et al., 2011
eye decreased size, abnormal	AB + MO1-bhmt	standard conditions	Fig. S5 from Yang et al., 2011
trunk decreased thickness, abnormal	AB + MO1-bhmt	standard conditions	Fig. S5 from Yang et al., 2011
exocrine pancreas decreased size, abnormal	WT + MO1-bhmt	standard conditions	Fig. 2 from Yang et al., 2011
liver decreased size, abnormal	WT + MO1-bhmt	standard conditions	Fig. 2 from Yang et al., 2011
intestine decreased size, abnormal	WT + MO1-bhmt	standard conditions	Fig. 2 from Yang et al., 2011
pancreatic B cell increased amount, abnormal	zf5Tg + MO1-bhmt	standard conditions	Fig. 4 from Yang et al., 2011

Citations