Morpholino

MO1-mnx1

ID
ZDB-MRPHLNO-111028-1
Name
MO1-mnx1
Previous Names
None
Target
Sequence
5' - AACAGATTAACGCCTCGTTCGTAAC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO targeted to 5-prime UTR of mnx1.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-mnx1
Phenotype
Phenotype resulting from MO1-mnx1
Phenotype of all Fish created by or utilizing MO1-mnx1
Phenotype Fish Conditions Figures
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO1-mnx1 standard conditions Fig. 2 with imageFig. 4 with imageFig. 7 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
endocrine pancreas development increased process quality, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has fewer parts of type pancreatic B cell, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO1-mnx1 standard conditions Fig. 4 with imageFig. 7 with image from Dalgin et al., 2011
retinoic acid receptor signaling pathway increased occurrence, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
posterior pancreatic bud has extra parts of type pancreatic A cell, abnormal AB + MO1-mnx1 standard conditions Fig. 4 with imageFig. 7 with imageFig. S6 with image from Dalgin et al., 2011
type B pancreatic cell differentiation decreased occurrence, abnormal AB + MO1-mnx1 chemical treatment: all-trans-retinoic acid Fig. 7 with image from Dalgin et al., 2011
endocrine pancreas development decreased process quality, abnormal AB + MO1-mnx1 standard conditions Fig. 2 with image from Dalgin et al., 2011
pancreatic A cell differentiation increased occurrence, abnormal AB + MO1-mnx1 standard conditions Fig. 4 with imageFig. 7 with imageFig. S6 with image from Dalgin et al., 2011
endocrine pancreas has fewer parts of type pancreatic B cell, abnormal nl1Tg + MO1-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
endocrine pancreas has extra parts of type pancreatic A cell, abnormal nl1Tg + MO1-mnx1 standard conditions Fig. 5 with image from Dalgin et al., 2011
Citations