Morpholino

MO3-bmpr2a

ID
ZDB-MRPHLNO-110729-1
Name
MO3-bmpr2a
Previous Names
  • bmpr2a #1 (1)
Target
Sequence
5' - AGAGAAACGTATTTGCATACCTTGC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-bmpr2a
No data available
Phenotype
Phenotype resulting from MO3-bmpr2a
Phenotype Fish Figures
angiogenesis disrupted, abnormal WT + MO3-bmpr2a Fig. 3,  Fig. S5 from Wiley et al., 2011
caudal vein plexus decreased size, abnormal s843Tg + MO3-bmpr2a Fig. 3 from Wiley et al., 2011
caudal vein plexus morphology, abnormal s843Tg + MO3-bmpr2a Fig. 2 with image from Kim et al., 2012
sprouting angiogenesis disrupted, abnormal s843Tg + MO3-bmpr2a Fig. 2 with image from Kim et al., 2012
venous blood vessel morphogenesis disrupted, abnormal s843Tg + MO3-bmpr2a Fig. 3 from Wiley et al., 2011
Phenotype of all Fish created by or utilizing MO3-bmpr2a
Phenotype Fish Conditions Figures
angiogenesis disrupted, abnormal WT + MO3-bmpr2a standard conditions Fig. S5 from Wiley et al., 2011
angiogenesis disrupted, abnormal s843Tg + MO3-bmpr2a standard conditions Fig. 3 from Wiley et al., 2011
caudal vein plexus decreased size, abnormal s843Tg + MO3-bmpr2a standard conditions Fig. 3 from Wiley et al., 2011
sprouting angiogenesis disrupted, abnormal s843Tg + MO3-bmpr2a standard conditions Fig. 2 with image from Kim et al., 2012
venous blood vessel morphogenesis disrupted, abnormal s843Tg + MO3-bmpr2a standard conditions Fig. 3 from Wiley et al., 2011
caudal vein plexus morphology, abnormal s843Tg + MO3-bmpr2a standard conditions Fig. 2 with image from Kim et al., 2012
caudal vein plexus morphology, abnormal s843Tg + MO1-dab2 + MO3-bmpr2a standard conditions Fig. 2 with image from Kim et al., 2012
sprouting angiogenesis disrupted, abnormal s843Tg + MO1-dab2 + MO3-bmpr2a standard conditions Fig. 2 with image from Kim et al., 2012
caudal vein plexus decreased width, abnormal y1Tg + MO3-bmpr2a + MO3-bmpr2b standard conditions Fig. 4 with image from Wakayama et al., 2015
caudal vein plexus malformed, abnormal y1Tg + MO3-bmpr2a + MO3-bmpr2b standard conditions Fig. 4 with image from Wakayama et al., 2015
caudal vein plexus malformed, abnormal y1Tg + MO1-arhgef9b + MO3-bmpr2a + MO3-bmpr2b standard conditions Fig. 4 with image from Wakayama et al., 2015
caudal vein plexus decreased width, abnormal y1Tg + MO1-arhgef9b + MO3-bmpr2a + MO3-bmpr2b standard conditions Fig. 4 with image from Wakayama et al., 2015
caudal vein plexus malformed, abnormal y1Tg + MO1-fmnl3 + MO3-bmpr2a + MO3-bmpr2b standard conditions Fig. S6 with image from Wakayama et al., 2015
caudal vein plexus decreased width, abnormal y1Tg + MO1-fmnl3 + MO3-bmpr2a + MO3-bmpr2b standard conditions Fig. S6 with image from Wakayama et al., 2015
post-vent vasculature mislocalised, abnormal fr13Tg; s843Tg + MO3-bmpr2a heat shock Fig. 3 from Wiley et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.