Morpholino

MO1-igfbp7

ID

ZDB-MRPHLNO-110610-1

Name

MO1-igfbp7

Previous Names

AGM-ATG-MO (1)

Target

igfbp7 (1)

Sequence

5' - GGCGAGGACGAGAACACACAGCATG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-igfbp7

No data available

Phenotype

Phenotype resulting from MO1-igfbp7

Phenotype	Fish	Figures
blood cell decreased amount, abnormal	AB/TU + MO1-igfbp7	text only from Hooper et al., 2009
blood circulation decreased occurrence, abnormal	AB/TU + MO1-igfbp7	Fig. 5, Fig. 6 from Hooper et al., 2009
brain morphology, abnormal	AB/TU + MO1-igfbp7	Fig. 5 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal	y1Tg + MO1-igfbp7	Fig. 5, Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel hypoplastic, abnormal	y1Tg + MO1-igfbp7	Fig. 6 from Hooper et al., 2009
extension morphology, abnormal	AB/TU + MO1-igfbp7	Fig. 5 from Hooper et al., 2009
heart contraction disrupted, abnormal	AB/TU + MO1-igfbp7	text only from Hooper et al., 2009
hemopoiesis disrupted, abnormal	AB/TU + MO1-igfbp7	text only from Hooper et al., 2009
intersegmental vessel decreased length, abnormal	y1Tg + MO1-igfbp7	Fig. 5 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal	y1Tg + MO1-igfbp7	Fig. 5, Fig. 6 from Hooper et al., 2009
melanocyte absent, abnormal	AB/TU + MO1-igfbp7	Fig. 5 from Hooper et al., 2009
pericardium edematous, abnormal	AB/TU + MO1-igfbp7	Fig. 5 from Hooper et al., 2009
pigmentation delayed, abnormal	AB/TU + MO1-igfbp7	Fig. 5 from Hooper et al., 2009
whole organism anterior-posterior axis decreased length, abnormal	AB/TU + MO1-igfbp7	Fig. 5 from Hooper et al., 2009

Phenotype of all Fish created by or utilizing MO1-igfbp7

Phenotype	Fish	Conditions	Figures
blood circulation decreased occurrence, abnormal	AB/TU + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
whole organism anterior-posterior axis decreased length, abnormal	AB/TU + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
extension morphology, abnormal	AB/TU + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
brain morphology, abnormal	AB/TU + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
pericardium edematous, abnormal	AB/TU + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
heart contraction disrupted, abnormal	AB/TU + MO1-igfbp7	standard conditions	text only from Hooper et al., 2009
melanocyte absent, abnormal	AB/TU + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
blood cell decreased amount, abnormal	AB/TU + MO1-igfbp7	standard conditions	text only from Hooper et al., 2009
hemopoiesis disrupted, abnormal	AB/TU + MO1-igfbp7	standard conditions	text only from Hooper et al., 2009
pigmentation delayed, abnormal	AB/TU + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal	y1Tg + MO1-igfbp7	standard conditions	Fig. 5, Fig. 6 from Hooper et al., 2009
intersegmental vessel decreased length, abnormal	y1Tg + MO1-igfbp7	standard conditions	Fig. 5 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal	y1Tg + MO1-igfbp7	standard conditions	Fig. 5, Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel hypoplastic, abnormal	y1Tg + MO1-igfbp7	standard conditions	Fig. 6 from Hooper et al., 2009
blood circulation decreased occurrence, abnormal	y1Tg + MO1-igfbp7	standard conditions	Fig. 6 from Hooper et al., 2009
dorsal longitudinal anastomotic vessel aplastic, abnormal	y1Tg + MO1-igfbp7 + MO1-vegfaa	standard conditions	Fig. 6 from Hooper et al., 2009
blood circulation decreased occurrence, abnormal	y1Tg + MO1-igfbp7 + MO1-vegfaa	standard conditions	Fig. 6 from Hooper et al., 2009
intersegmental vessel non-functional, abnormal	y1Tg + MO1-igfbp7 + MO1-vegfaa	standard conditions	Fig. 6 from Hooper et al., 2009
branching involved in blood vessel morphogenesis process quality, abnormal	y1Tg + MO1-igfbp7 + MO1-vegfaa	standard conditions	Fig. 6 from Hooper et al., 2009
intersegmental vessel irregular spatial pattern, abnormal	y1Tg + MO1-igfbp7 + MO1-vegfaa	standard conditions	Fig. 6 from Hooper et al., 2009
sprouting angiogenesis decreased occurrence, abnormal	y1Tg + MO1-igfbp7 + MO1-vegfaa	standard conditions	Fig. 6 from Hooper et al., 2009
intersegmental vessel decreased length, abnormal	y1Tg + MO1-igfbp7 + MO1-vegfaa	standard conditions	Fig. 6 from Hooper et al., 2009

Citations