Morpholino

MO1-thsd7aa

ID
ZDB-MRPHLNO-110531-1
Name
MO1-thsd7aa
Previous Names
None
Target
Sequence
5' - TGTATGTTTTTACCCACCATGACTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-thsd7aa
Expressed Gene Anatomy Figures
flt4 Fig. 6 from Liu et al., 2016
kdrl Fig. 6 from Liu et al., 2016
notch1b Fig. 4,  Fig. 5 with image from Liu et al., 2016
nrarpb Fig. 6 from Liu et al., 2016
thsd7aa Fig. 4 from Liu et al., 2016
Fig. 5 with image from Wang et al., 2011
Phenotype
Phenotype resulting from MO1-thsd7aa
Phenotype Fish Figures
atrioventricular canal development process quality, abnormal AB + MO1-thsd7aa Fig. 5 with image from Liu et al., 2016
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO1-thsd7aa Fig. 4 with image,  Fig. 5 with image from Wang et al., 2011
heart notch1b expression mislocalised, abnormal AB + MO1-thsd7aa Fig. 5 with image from Liu et al., 2016
heart looping decreased occurrence, abnormal AB + MO1-thsd7aa Fig. 5 with image from Liu et al., 2016
hindbrain notch1b expression spatial pattern, abnormal AB + MO1-thsd7aa Fig. 5 with image from Liu et al., 2016
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-thsd7aa Fig. 4 with image from Wang et al., 2011
intersegmental vessel spatial pattern, abnormal y1Tg + MO1-thsd7aa Fig. 4 with image,  Fig. 5 with image from Wang et al., 2011
spinal cord notch1b expression decreased amount, abnormal AB + MO1-thsd7aa Fig. 5 with image from Liu et al., 2016
whole organism kdrl expression decreased amount, abnormal AB + MO1-thsd7aa Fig. 6 from Liu et al., 2016
whole organism notch1b expression decreased amount, abnormal AB + MO1-thsd7aa Fig. 4 from Liu et al., 2016
whole organism flt4 expression decreased amount, abnormal AB + MO1-thsd7aa Fig. 6 from Liu et al., 2016
whole organism nrarpb expression decreased amount, abnormal AB + MO1-thsd7aa Fig. 6 from Liu et al., 2016
whole organism thsd7aa expression decreased amount, abnormal AB + MO1-thsd7aa Fig. 4 from Liu et al., 2016
Phenotype of all Fish created by or utilizing MO1-thsd7aa
Phenotype Fish Conditions Figures
heart notch1b expression mislocalised, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
whole organism nrarpb expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 6 from Liu et al., 2016
atrioventricular canal development process quality, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
whole organism kdrl expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 6 from Liu et al., 2016
whole organism thsd7aa expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 4 from Liu et al., 2016
whole organism flt4 expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 6 from Liu et al., 2016
spinal cord notch1b expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
heart looping decreased occurrence, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
hindbrain notch1b expression spatial pattern, abnormal AB + MO1-thsd7aa standard conditions Fig. 5 with image from Liu et al., 2016
whole organism notch1b expression decreased amount, abnormal AB + MO1-thsd7aa standard conditions Fig. 4 from Liu et al., 2016
blood vessel endothelial cell migration disrupted, abnormal y1Tg + MO1-thsd7aa standard conditions Fig. 4 with image,  Fig. 5 with image from Wang et al., 2011
intersegmental vessel increased branchiness, abnormal y1Tg + MO1-thsd7aa standard conditions Fig. 4 with image from Wang et al., 2011
intersegmental vessel spatial pattern, abnormal y1Tg + MO1-thsd7aa standard conditions Fig. 4 with image,  Fig. 5 with image from Wang et al., 2011
parachordal vessel angiogenesis decreased occurrence, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
MiP motor neuron axon development process quality, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
secondary motor neuron axon development process quality, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
RoP motor neuron axon absent, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
MiP motor neuron axon decreased length, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
RoP motor neuron axon morphology, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
secondary motor neuron axon morphology, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
horizontal myoseptum lacks parts or has fewer parts of type RoP motor neuron axon, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
RoP motor neuron axon development decreased occurrence, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
MiP motor neuron axon morphology, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
parachordal vessel absent, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
parachordal vessel aplastic, abnormal s843Tg; vu504Tg + MO1-thsd7aa + MO2-thsd7aa standard conditions Fig. 3 with image from Liu et al., 2016
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.