Morpholino

MO2-chsy1

ID

ZDB-MRPHLNO-110301-1

Name

MO2-chsy1

Previous Names

chsy1-UTR (1)

Target

chsy1 (1)

Sequence

5' - CTAGTCGCTTTAATTTGTCAGAGTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation-blocking MO. Targets 5'UTR.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-chsy1

No data available

Phenotype

Phenotype resulting from MO2-chsy1

Phenotype	Fish	Figures
ethmoid cartilage malformed, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
eye fused with eye, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
forebrain medial region aplastic, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
head bulbous, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
notochord degenerate, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
notochord undulate, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
optic fissure present, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
optic furrow open, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
pars superior ear morphology, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 5 from Li et al., 2010
pectoral fin fold decreased size, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
pectoral fin fold variability of size, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
trabecula cranii malformed, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
ventral mandibular arch protruding, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010
whole organism decreased length, abnormal	WT + MO2-chsy1 + MO4-tp53	Fig. 4 from Li et al., 2010

Phenotype of all Fish created by or utilizing MO2-chsy1

Phenotype	Fish	Conditions	Figures
trabecula cranii malformed, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
forebrain medial region aplastic, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
ventral mandibular arch protruding, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
head bulbous, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
eye fused with eye, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
pectoral fin fold decreased size, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
pars superior ear morphology, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 5 from Li et al., 2010
pectoral fin fold variability of size, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
optic furrow open, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
ethmoid cartilage malformed, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
notochord degenerate, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
whole organism decreased length, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
notochord undulate, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010
optic fissure present, abnormal	WT + MO2-chsy1 + MO4-tp53	standard conditions	Fig. 4 from Li et al., 2010

Citations