Morpholino

MO2-eve1

ID
ZDB-MRPHLNO-110111-1
Name
MO2-eve1
Previous Names
  • eveMO (1)
Target
Sequence
5' - CTGTAGGCTACTTACGCATTTTGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-eve1
No data available
Phenotype
Phenotype resulting from MO2-eve1
No data available
Phenotype of all Fish created by or utilizing MO2-eve1
Phenotype Fish Conditions Figures
tail bud duplicated, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
embryonic pattern specification process quality, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 5 with image from Seebald et al., 2011
caudal fin mislocalised, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
caudal fin duplicated, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
somite increased width, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
tail bud mislocalised, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 7 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-ved + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression spatial pattern, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression increased distribution, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
presumptive mesoderm tbx16l expression decreased distribution, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
cellular response to BMP stimulus process quality, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm tbx16l expression spatial pattern, abnormal AB + MO1-ved + MO1-vent + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression spatial pattern, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression increased distribution, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
cellular response to BMP stimulus process quality, abnormal AB + MO1-ved + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression spatial pattern, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm tbx16l expression decreased distribution, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation disrupted, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
presumptive mesoderm tbx16l expression spatial pattern, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
presumptive mesoderm ventral region chrd expression increased distribution, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
whole organism wholly dorsalized, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 2 with image from Seebald et al., 2011
cellular response to BMP stimulus process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
dorsal/ventral pattern formation process quality, abnormal AB + MO1-vent + MO1-vox + MO2-eve1 standard conditions Fig. 6 with image from Seebald et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.