Morpholino

MO2-dachb

ID
ZDB-MRPHLNO-101217-1
Name
MO2-dachb
Previous Names
  • dachb-MO-S (1)
Target
Sequence
5' - CTCAATGAGGGTTTACCTGTGGGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.Targets the exon2?intron2 splice boundary.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-dachb
Phenotype
Phenotype resulting from MO2-dachb
Phenotype Fish Figures
endocrine pancreas development disrupted, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with image from Yang et al., 2021
Fig. 2 with image from Kalousova et al., 2010
islet ab2-isl labeling decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with image from Yang et al., 2021
islet shape, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with image from Yang et al., 2021
islet cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with imageFig. 5 with image from Yang et al., 2021
islet cell decreased volume, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with imageFig. 5 with image from Yang et al., 2021
pancreatic B cell ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with image from Yang et al., 2021
pancreatic B cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with imageFig. 5 with image from Yang et al., 2021
posterior pancreatic bud endocrine cell decreased amount, abnormal WT + MO2-dachb Fig. 2 with image from Kalousova et al., 2010
type B pancreatic cell development disrupted, abnormal AB + MO2-dachb + MO4-tp53 Fig. 4 with image from Yang et al., 2021
whole organism sst2 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 8 with image from Yang et al., 2021
whole organism ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 8 with image from Yang et al., 2021
whole organism insm1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 8 with image from Yang et al., 2021
whole organism ptf1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 8 with image from Yang et al., 2021
whole organism nkx6.1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 8 with image from Yang et al., 2021
whole organism dacha expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 7 with image from Yang et al., 2021
whole organism dachb expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 3 with imageFig. 7 with image from Yang et al., 2021
whole organism pax6a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 8 with image from Yang et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 Fig. 8 with image from Yang et al., 2021
Phenotype of all Fish created by or utilizing MO2-dachb
Phenotype Fish Conditions Figures
whole organism ptf1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism pax6a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
islet ab2-isl labeling decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
islet cell decreased volume, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
whole organism sst2 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
islet cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
type B pancreatic cell development disrupted, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
pancreatic B cell decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with imageFig. 5 with image from Yang et al., 2021
endocrine pancreas development disrupted, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism dachb expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 3 with imageFig. 7 with image from Yang et al., 2021
whole organism ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism dacha expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 7 with image from Yang et al., 2021
whole organism nkx6.1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
pancreatic B cell ins expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
whole organism insm1a expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
whole organism neurod1 expression decreased amount, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 8 with image from Yang et al., 2021
islet shape, abnormal AB + MO2-dachb + MO4-tp53 standard conditions Fig. 4 with image from Yang et al., 2021
posterior pancreatic bud endocrine cell decreased amount, abnormal WT + MO2-dachb standard conditions Fig. 2 with image from Kalousova et al., 2010
endocrine pancreas development disrupted, abnormal WT + MO2-dachb standard conditions Fig. 2 with image from Kalousova et al., 2010
Citations