Morpholino

MO3-irx7

ID
ZDB-MRPHLNO-101008-5
Name
MO3-irx7
Previous Names
  • irx7SMO (1)
Target
Sequence
5' - GTCAAAATACTACTTACAATGTGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO3-irx7
No data available
Phenotype
Phenotype resulting from MO3-irx7
Phenotype Fish Figures
amacrine cell decreased amount, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
amacrine cell neuron projection decreased amount, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
camera-type eye photoreceptor cell differentiation disrupted, abnormal AB + MO3-irx7 Fig. 6 with image from Zhang et al., 2012
cell cycle process disrupted, abnormal AB + MO3-irx7 Fig. 7 with image from Zhang et al., 2012
eye decreased size, abnormal AB + MO3-irx7 Fig. 3 with imageFig. 5 with image from Zhang et al., 2012
horizontal cell decreased amount, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
neural retina development disrupted, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
photoreceptor cell shortened, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retina decreased area, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retina layer formation disrupted, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal bipolar neuron decreased amount, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal bipolar neuron differentiation disrupted, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal cone cell decreased amount, abnormal AB + MO3-irx7 Fig. 6 with imageFig. 10 with image from Zhang et al., 2012
retinal inner nuclear layer decreased thickness, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal inner nuclear layer lacks all parts of type Muller cell, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal inner nuclear layer morphology, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal inner plexiform layer decreased thickness, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal outer plexiform layer decreased thickness, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
retinal rod cell decreased amount, abnormal AB + MO3-irx7 Fig. 6 with image from Zhang et al., 2012
whole organism lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal AB + MO3-irx7 Fig. 5 with image from Zhang et al., 2012
whole organism morphology, abnormal AB + MO3-irx7 Fig. 3 with image from Zhang et al., 2012
Phenotype of all Fish created by or utilizing MO3-irx7
Phenotype Fish Conditions Figures
neural retina development disrupted, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
cell cycle process disrupted, abnormal AB + MO3-irx7 standard conditions Fig. 7 with image from Zhang et al., 2012
amacrine cell decreased amount, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
whole organism morphology, abnormal AB + MO3-irx7 standard conditions Fig. 3 with image from Zhang et al., 2012
retinal bipolar neuron differentiation disrupted, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retinal inner plexiform layer decreased thickness, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
camera-type eye photoreceptor cell differentiation disrupted, abnormal AB + MO3-irx7 standard conditions Fig. 6 with image from Zhang et al., 2012
retinal inner nuclear layer morphology, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retinal outer plexiform layer decreased thickness, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retinal rod cell decreased amount, abnormal AB + MO3-irx7 standard conditions Fig. 6 with image from Zhang et al., 2012
retinal bipolar neuron decreased amount, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retinal inner nuclear layer decreased thickness, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retina layer formation disrupted, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retina decreased area, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retinal cone cell decreased amount, abnormal AB + MO3-irx7 standard conditions Fig. 6 with imageFig. 10 with image from Zhang et al., 2012
whole organism lacks parts or has fewer parts of type retinal ganglion cell neuron projection, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
retinal inner nuclear layer lacks all parts of type Muller cell, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
photoreceptor cell shortened, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
eye decreased size, abnormal AB + MO3-irx7 standard conditions Fig. 3 with imageFig. 5 with image from Zhang et al., 2012
horizontal cell decreased amount, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
amacrine cell neuron projection decreased amount, abnormal AB + MO3-irx7 standard conditions Fig. 5 with image from Zhang et al., 2012
Citations