Morpholino

MO1-nphp3

ID
ZDB-MRPHLNO-100629-2
Name
MO1-nphp3
Previous Names
  • AUG MO (1)
  • MO1-si:dkey-56l10.1
Target
Sequence
5' - TGCCGTACCCATAACAACTGATAAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nphp3
No data available
Phenotype
Phenotype resulting from MO1-nphp3
Phenotype of all Fish created by or utilizing MO1-nphp3
Phenotype Fish Conditions Figures
Kupffer's vesicle cilium decreased length, abnormal WT + MO1-nphp3 standard conditions Fig. 4 from Zhou et al., 2010
Kupffer's vesicle cilium decreased amount, abnormal WT + MO1-nphp3 standard conditions Fig. 4 from Zhou et al., 2010
atrium mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
whole organism curved ventral, abnormal WT + MO1-nphp3 standard conditions Fig. 2 from Zhou et al., 2010
whole organism decreased length, abnormal WT + MO1-nphp3 standard conditions Fig. 6 from Zhou et al., 2010
heart jogging disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
fourth ventricle hydrocephalic, abnormal WT + MO1-nphp3 standard conditions Fig. 2 from Zhou et al., 2010
pronephros cystic, abnormal WT + MO1-nphp3 standard conditions Fig. 2 from Zhou et al., 2010
determination of left/right asymmetry in lateral mesoderm disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
liver mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
cardiac ventricle mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
convergent extension involved in somitogenesis disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 6 from Zhou et al., 2010
pancreas mislocalised, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-nphp3 standard conditions Fig. 3 from Zhou et al., 2010
liver development disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
liver mislocalised, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of pancreatic left/right asymmetry disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
determination of left/right symmetry disrupted, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
pancreas mislocalised, abnormal WT + MO1-nphp3 + MO2-invs standard conditions Fig. 3 from Zhou et al., 2010
Citations