Morpholino

MO2-ppp1r12a

ID
ZDB-MRPHLNO-100525-6
Name
MO2-ppp1r12a
Previous Names
None
Target
Sequence
5' - ATTTTTTGTGACTTACTCAGCGATG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-ppp1r12a
Expressed Gene Anatomy Figures
epha4a Figure 3 with image from Cayuso et al., 2019
rfng Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
wwtr1 Figure 6 with image from Cayuso et al., 2019
Phenotype
Phenotype resulting from MO2-ppp1r12a
Phenotype Fish Figures
actin filament bundle distribution disrupted, abnormal AB + MO2-ppp1r12a Fig. 6 with image from Gutzman et al., 2015
midbrain hindbrain boundary basal side increased angle to brain epithelium, abnormal AB + MO2-ppp1r12a Fig. 3 with image from Gutzman et al., 2015
midbrain hindbrain boundary cell decreased length, abnormal AB + MO2-ppp1r12a Fig. 4 with image from Gutzman et al., 2015
midbrain hindbrain boundary cell increased area, abnormal AB + MO2-ppp1r12a Fig. 5 with image from Gutzman et al., 2015
midbrain hindbrain boundary cell increased width, abnormal AB + MO2-ppp1r12a Fig. 5 with image from Gutzman et al., 2015
midbrain hindbrain boundary constriction cell decreased length, abnormal WT + MO2-ppp1r12a Fig. 4 with image from Sahu et al., 2017
midbrain-hindbrain boundary morphogenesis disrupted, abnormal AB + MO2-ppp1r12a Fig. 3 with image from Gutzman et al., 2015
neuroepithelial cell actin filament decreased accumulation midbrain hindbrain boundary basal region, abnormal AB + MO2-ppp1r12a Fig. 6 with image from Gutzman et al., 2015
rhombomere 1 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a Figure 6 with image from Cayuso et al., 2019
rhombomere 1 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 2 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a Figure 6 with image from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 3 posterior margin wwtr1 expression spatial pattern, abnormal WT + MO2-ppp1r12a Figure 6 with image from Cayuso et al., 2019
rhombomere 4 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 4 posterior margin wwtr1 expression spatial pattern, abnormal WT + MO2-ppp1r12a Figure 6 with image from Cayuso et al., 2019
rhombomere 5 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a Figure 6 with image from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 6 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a Figure 6 with image from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
Phenotype of all Fish created by or utilizing MO2-ppp1r12a
Phenotype Fish Conditions Figures
midbrain hindbrain boundary cell increased width, abnormal AB + MO2-ppp1r12a standard conditions Fig. 5 with image from Gutzman et al., 2015
neuroepithelial cell actin filament decreased accumulation midbrain hindbrain boundary basal region, abnormal AB + MO2-ppp1r12a standard conditions Fig. 6 with image from Gutzman et al., 2015
midbrain hindbrain boundary basal side increased angle to brain epithelium, abnormal AB + MO2-ppp1r12a standard conditions Fig. 3 with image from Gutzman et al., 2015
midbrain hindbrain boundary cell decreased length, abnormal AB + MO2-ppp1r12a standard conditions Fig. 4 with image from Gutzman et al., 2015
midbrain hindbrain boundary cell increased area, abnormal AB + MO2-ppp1r12a standard conditions Fig. 5 with image from Gutzman et al., 2015
midbrain-hindbrain boundary morphogenesis disrupted, abnormal AB + MO2-ppp1r12a standard conditions Fig. 3 with image from Gutzman et al., 2015
actin filament bundle distribution disrupted, abnormal AB + MO2-ppp1r12a standard conditions Fig. 6 with image from Gutzman et al., 2015
rhombomere 5 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a standard conditions Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 3 posterior margin wwtr1 expression spatial pattern, abnormal WT + MO2-ppp1r12a standard conditions Figure 6 with image from Cayuso et al., 2019
rhombomere 5 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a standard conditions Figure 6 with image from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a standard conditions Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
midbrain hindbrain boundary constriction cell length, ameliorated WT + MO2-ppp1r12a chemical treatment by environment: 2-aminoethoxydiphenylborane Fig. 4 with image from Sahu et al., 2017
rhombomere 4 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a standard conditions Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 6 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a standard conditions Figure 6 with image from Cayuso et al., 2019
midbrain hindbrain boundary constriction cell decreased length, abnormal WT + MO2-ppp1r12a control Fig. 4 with image from Sahu et al., 2017
rhombomere 3 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a standard conditions Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 1 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a standard conditions Figure 6 with image from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a standard conditions Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 1 posterior margin rfng expression increased distribution, abnormal WT + MO2-ppp1r12a standard conditions Figure 3 with image,  Figure 4. with image from Cayuso et al., 2019
rhombomere 4 posterior margin wwtr1 expression spatial pattern, abnormal WT + MO2-ppp1r12a standard conditions Figure 6 with image from Cayuso et al., 2019
rhombomere 2 posterior margin wwtr1 expression amount, ameliorated WT + MO2-ppp1r12a standard conditions Figure 6 with image from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression amount, ameliorated efnb3bfci9/fci9 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 4 posterior margin rfng expression amount, ameliorated efnb3bfci9/fci9 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression amount, ameliorated efnb3bfci9/fci9 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression amount, ameliorated efnb3bfci9/fci9 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 1 posterior margin rfng expression amount, ameliorated efnb3bfci9/fci9 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression amount, ameliorated efnb3bfci9/fci9 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression amount, ameliorated epha4afci5/fci5 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 4 posterior margin rfng expression amount, ameliorated epha4afci5/fci5 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression amount, ameliorated epha4afci5/fci5 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression amount, ameliorated epha4afci5/fci5 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 1 posterior margin rfng expression amount, ameliorated epha4afci5/fci5 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression decreased distribution, abnormal epha4afci5/fci5 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 4 posterior margin rfng expression amount, ameliorated epha4afci6/fci6 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression amount, ameliorated epha4afci6/fci6 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression amount, ameliorated epha4afci6/fci6 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression decreased distribution, abnormal epha4afci6/fci6 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 1 posterior margin rfng expression amount, ameliorated epha4afci6/fci6 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression decreased distribution, abnormal epha4afci6/fci6 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 6 posterior margin rfng expression amount, ameliorated epha4afci7/fci7 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 3 posterior margin rfng expression amount, ameliorated epha4afci7/fci7 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 4 posterior margin rfng expression amount, ameliorated epha4afci7/fci7 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 5 posterior margin rfng expression amount, ameliorated epha4afci7/fci7 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 1 posterior margin rfng expression amount, ameliorated epha4afci7/fci7 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
rhombomere 2 posterior margin rfng expression amount, ameliorated epha4afci7/fci7 + MO2-ppp1r12a standard conditions Figure 4. with image from Cayuso et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.