Morpholino

MO2-cldn5a

ID
ZDB-MRPHLNO-100525-1
Name
MO2-cldn5a
Previous Names
None
Target
Sequence
5' - AGGCCATCGCTTTCTTTTCCCACTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-cldn5a
Phenotype
Phenotype resulting from MO2-cldn5a
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal TU + MO2-cldn5a Fig. S4 with image from Kim et al., 2017
dorsal aorta ab1-cldn5 labeling absent, abnormal WT + MO2-cldn5a Fig. 5 from Yang et al., 2020
dorsal aorta decreased diameter, abnormal WT + MO2-cldn5a Fig. 3 from Yang et al., 2020
dorsal aorta unlumenized, abnormal WT + MO2-cldn5a Fig. 3 from Yang et al., 2020
dorsal aorta blood vessel endothelial cell migration increased occurrence, abnormal y7Tg + MO2-cldn5a Fig. 4 from Yang et al., 2020
dorsal aorta blood vessel lumenization decreased process quality, abnormal WT + MO2-cldn5a Fig. 3 from Yang et al., 2020
establishment of endothelial barrier disrupted, abnormal lri500Tg; s896Tg + MO2-cldn5a Fig. S6 with image from Xie et al., 2010
fourth ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 Fig. 3 with image from Zhang et al., 2010
heart tube mislocalised, abnormal TU + MO2-cldn5a Fig. S4 with image from Kim et al., 2017
hyaloid vessel broken, abnormal lri500Tg; s896Tg + MO2-cldn5a Fig. S6 with image from Xie et al., 2010
Kupffer's vesicle ab1-cldn5 labeling absent, abnormal s870Tg + MO2-cldn5a Fig. S2 with image from Kim et al., 2017
neuroepithelial cell bicellular tight junction increased permeability, abnormal AB + MO2-cldn5a Fig. 1 with image from Zhang et al., 2010
tectal ventricle decreased volume, abnormal AB + MO2-cldn5a Fig. 3 with image from Zhang et al., 2010
ventricular system lumenized, abnormal AB + MO2-cldn5a + MO4-tp53 Fig. 3 with image from Zhang et al., 2010
ventricular system development disrupted, abnormal AB + MO2-cldn5a + MO4-tp53 Fig. 3 with image from Zhang et al., 2010
Phenotype of all Fish created by or utilizing MO2-cldn5a
Phenotype Fish Conditions Figures
tectal ventricle decreased volume, abnormal AB + MO2-cldn5a standard conditions Fig. 3 with image from Zhang et al., 2010
ventricular system lumenized, abnormal AB + MO2-cldn5a standard conditions Fig. 3 with image from Zhang et al., 2010
ventricular system development disrupted, abnormal AB + MO2-cldn5a standard conditions Fig. 3 with image from Zhang et al., 2010
fourth ventricle decreased volume, abnormal AB + MO2-cldn5a standard conditions Fig. 3 with image from Zhang et al., 2010
neuroepithelial cell bicellular tight junction increased permeability, abnormal AB + MO2-cldn5a standard conditions Fig. 1 with image from Zhang et al., 2010
ventricular system development disrupted, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
fourth ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
ventricular system lumenized, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
tectal ventricle decreased volume, abnormal AB + MO2-cldn5a + MO4-tp53 standard conditions Fig. 3 with image from Zhang et al., 2010
determination of heart left/right asymmetry disrupted, abnormal TU + MO2-cldn5a standard conditions Fig. S4 with image from Kim et al., 2017
heart tube mislocalised, abnormal TU + MO2-cldn5a standard conditions Fig. S4 with image from Kim et al., 2017
dorsal aorta unlumenized, abnormal WT + MO2-cldn5a standard conditions Fig. 3 from Yang et al., 2020
dorsal aorta ab1-cldn5 labeling absent, abnormal WT + MO2-cldn5a standard conditions Fig. 5 from Yang et al., 2020
dorsal aorta decreased diameter, abnormal WT + MO2-cldn5a standard conditions Fig. 3 from Yang et al., 2020
dorsal aorta blood vessel lumenization decreased process quality, abnormal WT + MO2-cldn5a standard conditions Fig. 3 from Yang et al., 2020
Kupffer's vesicle ab1-cldn5 labeling absent, abnormal s870Tg + MO2-cldn5a standard conditions Fig. S2 with image from Kim et al., 2017
dorsal aorta blood vessel endothelial cell migration increased occurrence, abnormal y7Tg + MO2-cldn5a standard conditions Fig. 4 from Yang et al., 2020
hyaloid vessel broken, abnormal lri500Tg; s896Tg + MO2-cldn5a standard conditions Fig. S6 with image from Xie et al., 2010
establishment of endothelial barrier disrupted, abnormal lri500Tg; s896Tg + MO2-cldn5a standard conditions Fig. S6 with image from Xie et al., 2010
Citations