Morpholino
MO1-foxd5
- ID
- ZDB-MRPHLNO-100518-1
- Name
- MO1-foxd5
- Previous Names
- None
- Target
- Sequence
-
5' - GTTCGTAATCCTGCGAGAGGGTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Translation blocking MO.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxd5
Expressed Gene | Anatomy | Figures |
---|---|---|
dlc |
Fig. 3
from Lee et al., 2009 |
|
ephb2a |
Fig. 3
from Lee et al., 2009 |
|
her1 |
Fig. 3
from Lee et al., 2009 |
|
mespaa |
Fig. 4
from Lee et al., 2009 |
|
mespba |
Fig. 4
from Lee et al., 2009 |
|
notch2 |
Fig. 3
from Lee et al., 2009 |
|
notch3 |
Fig. 3
from Lee et al., 2009 |
|
pcdh8 |
Fig. 3
from Lee et al., 2009 |
|
tbx6 |
Fig. 4
from Lee et al., 2009 |
|
tcf15 |
Fig. 3
from Lee et al., 2009 |
|
xirp2a |
|
Fig. 2
from Lee et al., 2009 |
Phenotype
Phenotype resulting from MO1-foxd5
Phenotype of all Fish created by or utilizing MO1-foxd5
Citations