Morpholino

MO1-crbn

ID
ZDB-MRPHLNO-100503-5
Name
MO1-crbn
Previous Names
  • zCrbn MO (1)
Target
Sequence
5' - AGAGCTGTAGCTGGTTCCCCATTTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-crbn
Expressed Gene Anatomy Figures
ccnd1 Fig. S8 from Shen et al., 2021
fgf8a Fig. S14 from Ito et al., 2010
lef1 Fig. S8 from Shen et al., 2021
myca Fig. S8 from Shen et al., 2021
shha Fig. S14 from Ito et al., 2010
Phenotype
Phenotype resulting from MO1-crbn
Phenotype Fish Figures
apical ectodermal ridge pectoral fin bud physical object quality, abnormal WT + MO1-crbn Fig. S14 from Ito et al., 2010
embryonic pectoral fin morphogenesis process quality, abnormal WT + MO1-crbn Fig. 4,  Fig. S14 from Ito et al., 2010
eye decreased distance eye, abnormal NHGRI-1 + MO1-crbn Fig. S8 from Shen et al., 2021
otic vesicle decreased size, abnormal WT + MO1-crbn Fig. 4,  Fig. S14 from Ito et al., 2010
otic vesicle morphogenesis process quality, abnormal WT + MO1-crbn Fig. 4,  Fig. S14 from Ito et al., 2010
pectoral fin decreased size, abnormal WT + MO1-crbn Fig. 4 from Ito et al., 2010
pectoral fin malformed, abnormal WT + MO1-crbn Fig. 4 from Ito et al., 2010
whole organism lef1 expression decreased amount, abnormal NHGRI-1 + MO1-crbn Fig. S8 from Shen et al., 2021
whole organism myca expression decreased amount, abnormal NHGRI-1 + MO1-crbn Fig. S8 from Shen et al., 2021
whole organism ccnd1 expression decreased amount, abnormal NHGRI-1 + MO1-crbn Fig. S8 from Shen et al., 2021
Phenotype of all Fish created by or utilizing MO1-crbn
Phenotype Fish Conditions Figures
whole organism lef1 expression decreased amount, abnormal NHGRI-1 + MO1-crbn standard conditions Fig. S8 from Shen et al., 2021
whole organism ccnd1 expression decreased amount, abnormal NHGRI-1 + MO1-crbn standard conditions Fig. S8 from Shen et al., 2021
whole organism myca expression decreased amount, abnormal NHGRI-1 + MO1-crbn standard conditions Fig. S8 from Shen et al., 2021
eye decreased distance eye, abnormal NHGRI-1 + MO1-crbn standard conditions Fig. S8 from Shen et al., 2021
otic vesicle morphogenesis process quality, abnormal WT + MO1-crbn standard conditions Fig. 4,  Fig. S14 from Ito et al., 2010
pectoral fin malformed, abnormal WT + MO1-crbn standard conditions Fig. 4 from Ito et al., 2010
pectoral fin decreased size, abnormal WT + MO1-crbn standard conditions Fig. 4 from Ito et al., 2010
embryonic pectoral fin morphogenesis process quality, abnormal WT + MO1-crbn standard conditions Fig. 4,  Fig. S14 from Ito et al., 2010
otic vesicle decreased size, abnormal WT + MO1-crbn standard conditions Fig. 4,  Fig. S14 from Ito et al., 2010
apical ectodermal ridge pectoral fin bud physical object quality, abnormal WT + MO1-crbn standard conditions Fig. S14 from Ito et al., 2010
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.