Morpholino

MO1-appa

ID
ZDB-MRPHLNO-100414-4
Name
MO1-appa
Previous Names
  • appa-MO (1)
Target
Sequence
5' - ATGAAGAGCTCCTCGACCGCATGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Translation blocking MO.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-appa
No data available
Phenotype
Phenotype resulting from MO1-appa
No data available
Phenotype of all Fish created by or utilizing MO1-appa
Phenotype Fish Conditions Figures
caudal fin decreased length, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord development disrupted, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
caudal fin curled, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
eye decreased size, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
post-vent region decreased length, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord bifurcated, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
endodermal cell mislocalised laterally, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
myotome increased width, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord undulate, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
somite increased width, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
notochord increased width, abnormal WT + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Joshi et al., 2009
central artery shortened, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with imageFig. 3 with image from Luna et al., 2013
central artery decreased branchiness, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with imageFig. 3 with image from Luna et al., 2013
central artery decreased length, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with imageFig. 3 with image from Luna et al., 2013
ball increased size, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Luna et al., 2013
whole organism shortened, abnormal s843Tg + MO1-appa + MO1-appb standard conditions Fig. 2 with image from Luna et al., 2013
Citations