Morpholino

MO1-pcdh19

ID

ZDB-MRPHLNO-100406-1

Name

MO1-pcdh19

Previous Names

Target

Sequence

5' - TCCTTGGAATGCATTGTACCTGTTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

Translation blocking.

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-pcdh19

Expressed Gene	Anatomy	Figures
pcdh19	whole organism	Fig. 4 from Emond et al., 2009

Phenotype

Phenotype resulting from MO1-pcdh19

Phenotype	Fish	Figures
brain disorganized, abnormal	WT + MO1-pcdh19	Fig. 6 from Emond et al., 2009
convergent extension disrupted, abnormal	WT + MO1-pcdh19	Fig. 6 , Fig. 7 from Emond et al., 2009
neural keel increased width, abnormal	WT + MO1-pcdh19	Fig. 7 from Emond et al., 2009
neural rod collapsed, abnormal	WT + MO1-pcdh19	Fig. 6 from Emond et al., 2009
neural rod disorganized, abnormal	WT + MO1-pcdh19	Fig. 6 from Emond et al., 2009
neural rod increased width, abnormal	WT + MO1-pcdh19	Fig. 6 from Emond et al., 2009
neural rod Y-shaped, abnormal	WT + MO1-pcdh19	Fig. 6 from Emond et al., 2009
optic vesicle malformed, abnormal	WT + MO1-pcdh19	Fig. 6 from Emond et al., 2009
whole organism decreased length, abnormal	WT + MO1-pcdh19	Fig. 6 from Emond et al., 2009

Phenotype of all Fish created by or utilizing MO1-pcdh19

Phenotype	Fish	Conditions	Figures
brain disorganized, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 from Emond et al., 2009
whole organism decreased length, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 from Emond et al., 2009
convergent extension disrupted, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 , Fig. 7 from Emond et al., 2009
neural rod collapsed, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 from Emond et al., 2009
optic vesicle malformed, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 from Emond et al., 2009
neural rod increased width, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 from Emond et al., 2009
neural rod Y-shaped, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 from Emond et al., 2009
neural rod disorganized, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 6 from Emond et al., 2009
neural keel increased width, abnormal	WT + MO1-pcdh19	standard conditions	Fig. 7 from Emond et al., 2009

Citations