Morpholino

MO1-dync2h1

ID
ZDB-MRPHLNO-100217-23
Name
MO1-dync2h1
Previous Names
  • dync2-h1MO1 (1)
Target
Sequence
5' - CTGCTGTGAATGCATGTACCTGCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dync2h1
Expressed Gene Anatomy Figures
ift88 Fig. 6 from Krock et al., 2009
Phenotype
Phenotype resulting from MO1-dync2h1
Phenotype Fish Figures
eye decreased size, abnormal WT + MO1-dync2h1 Fig. 2,  Fig. 3 from Krock et al., 2009
intraciliary transport disrupted, abnormal WT + MO1-dync2h1 Fig. 6 from Krock et al., 2009
olfactory epithelium axoneme swollen, abnormal WT + MO1-dync2h1 Fig. 5 from Krock et al., 2009
olfactory epithelium non-motile cilium decreased length, abnormal WT + MO1-dync2h1 Fig. 5 from Krock et al., 2009
photoreceptor cell intraciliary transport particle spatial pattern, abnormal WT + MO1-dync2h1 Fig. 6 from Krock et al., 2009
photoreceptor cell photoreceptor connecting cilium swollen, abnormal WT + MO1-dync2h1 Fig. 4 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-dync2h1 Fig. 4 from Krock et al., 2009
pronephric duct motile cilium decreased amount, abnormal WT + MO1-dync2h1 Fig. 5 from Krock et al., 2009
pronephric duct motile cilium decreased length, abnormal WT + MO1-dync2h1 Fig. 5 from Krock et al., 2009
pronephros cystic, abnormal WT + MO1-dync2h1 Fig. 2,  Fig. 5 from Krock et al., 2009
whole organism curved ventral, abnormal WT + MO1-dync2h1 Fig. 2 from Krock et al., 2009
whole organism decreased length, abnormal WT + MO1-dync2h1 Fig. 2 from Krock et al., 2009
Phenotype of all Fish created by or utilizing MO1-dync2h1
Phenotype Fish Conditions Figures
photoreceptor cell photoreceptor connecting cilium swollen, abnormal WT + MO1-dync2h1 standard conditions Fig. 4 from Krock et al., 2009
olfactory epithelium non-motile cilium decreased length, abnormal WT + MO1-dync2h1 standard conditions Fig. 5 from Krock et al., 2009
pronephros cystic, abnormal WT + MO1-dync2h1 standard conditions Fig. 2,  Fig. 5 from Krock et al., 2009
pronephric duct motile cilium decreased length, abnormal WT + MO1-dync2h1 standard conditions Fig. 5 from Krock et al., 2009
pronephric duct motile cilium decreased amount, abnormal WT + MO1-dync2h1 standard conditions Fig. 5 from Krock et al., 2009
intraciliary transport disrupted, abnormal WT + MO1-dync2h1 standard conditions Fig. 6 from Krock et al., 2009
whole organism decreased length, abnormal WT + MO1-dync2h1 standard conditions Fig. 2 from Krock et al., 2009
photoreceptor cell photoreceptor outer segment decreased length, abnormal WT + MO1-dync2h1 standard conditions Fig. 4 from Krock et al., 2009
whole organism curved ventral, abnormal WT + MO1-dync2h1 standard conditions Fig. 2 from Krock et al., 2009
olfactory epithelium axoneme swollen, abnormal WT + MO1-dync2h1 standard conditions Fig. 5 from Krock et al., 2009
eye decreased size, abnormal WT + MO1-dync2h1 standard conditions Fig. 2,  Fig. 3 from Krock et al., 2009
photoreceptor cell intraciliary transport particle spatial pattern, abnormal WT + MO1-dync2h1 standard conditions Fig. 6 from Krock et al., 2009
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.