Morpholino

MO1-rtn4r

ID

ZDB-MRPHLNO-100202-3

Name

MO1-rtn4r

Previous Names

Target

Sequence

5' - CTCCACGATTAAGGTCTTCATGTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-rtn4r

No data available

Phenotype

Phenotype resulting from MO1-rtn4r

Phenotype	Fish	Figures
axon extension disrupted, abnormal	WT + MO1-rtn4r	Fig. 3 , Fig. 4 from Brösamle et al., 2009
axon guidance disrupted, abnormal	WT + MO1-rtn4r	Fig. 3 , Fig. 4 from Brösamle et al., 2009
branching morphogenesis of a nerve disrupted, abnormal	WT + MO1-rtn4r	Fig. 3 , Fig. 4 from Brösamle et al., 2009
cranial nerve morphology, abnormal	WT + MO1-rtn4r	Fig. 3 from Brösamle et al., 2009
innervation disrupted, abnormal	WT + MO1-rtn4r	Fig. 3 from Brösamle et al., 2009
peripheral nervous system neuron axonogenesis disrupted, abnormal	WT + MO1-rtn4r	Fig. 4 from Brösamle et al., 2009
posterior lateral line nerve decreased length, abnormal	WT + MO1-rtn4r	Fig. 4 from Brösamle et al., 2009
posterior lateral line nerve defasciculated, abnormal	WT + MO1-rtn4r	Fig. 4 from Brösamle et al., 2009

Phenotype of all Fish created by or utilizing MO1-rtn4r

Phenotype	Fish	Conditions	Figures
peripheral nervous system neuron axonogenesis disrupted, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 4 from Brösamle et al., 2009
posterior lateral line nerve defasciculated, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 4 from Brösamle et al., 2009
axon extension disrupted, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 3 , Fig. 4 from Brösamle et al., 2009
posterior lateral line nerve decreased length, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 4 from Brösamle et al., 2009
axon guidance disrupted, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 3 , Fig. 4 from Brösamle et al., 2009
branching morphogenesis of a nerve disrupted, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 3 , Fig. 4 from Brösamle et al., 2009
cranial nerve morphology, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 3 from Brösamle et al., 2009
innervation disrupted, abnormal	WT + MO1-rtn4r	standard conditions	Fig. 3 from Brösamle et al., 2009
posterior lateral line nerve development disrupted, abnormal	WT + MO1-rtn4r + MO3-rtn4a	standard conditions	text only from Brösamle et al., 2009
posterior lateral line nerve decreased length, abnormal	WT + MO1-rtn4r + MO3-rtn4a	standard conditions	text only from Brösamle et al., 2009

Citations