Morpholino

MO2-desma

ID

ZDB-MRPHLNO-100114-9

Name

MO2-desma

Previous Names

MO2-desm

Target

desma (1)

Sequence

5' - ATGACATAAAGTACATACAGCTCTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-desma

No data available

Phenotype

Phenotype resulting from MO2-desma

Phenotype	Fish	Figures
heart contraction process quality, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	Fig. 6 from Ramspacher et al., 2015
locomotion disrupted, abnormal	WT + MO2-desma	Fig. 2 from Bührdel et al., 2015
muscle cell vacuole increased amount, abnormal	WT + MO2-desma	Fig. 3 from Bührdel et al., 2015
pericardium edematous, abnormal	WT + MO2-desma	Fig. S4 from Bührdel et al., 2015
skeletal muscle refractivity, abnormal	WT + MO2-desma	Fig. 3 , Fig. S4 from Bührdel et al., 2015
skeletal muscle mitochondrial crista decreased amount, abnormal	WT + MO2-desma	Fig. 3 from Bührdel et al., 2015
skeletal muscle nucleus circular, abnormal	WT + MO2-desma	Fig. 3 from Bührdel et al., 2015
skeletal muscle sarcomere disorganized, abnormal	WT + MO2-desma	Fig. 3 from Bührdel et al., 2015
skeletal muscle cell alignment skeletal muscle cell, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	Fig. 6 from Ramspacher et al., 2015
skeletal muscle cell broken, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	Fig. 6 from Ramspacher et al., 2015
skeletal muscle cell structure, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	Fig. 6 from Ramspacher et al., 2015
swimming behavior process quality, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	Fig. 6 from Ramspacher et al., 2015
thigmotaxis disrupted, abnormal	WT + MO2-desma	Fig. 2 from Bührdel et al., 2015
trunk curved, abnormal	WT + MO2-desma	Fig. S4 from Bührdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO2-desma	Fig. 2 from Bührdel et al., 2015

Phenotype of all Fish created by or utilizing MO2-desma

Phenotype	Fish	Conditions	Figures
skeletal muscle cell structure, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	control	Fig. 6 from Ramspacher et al., 2015
skeletal muscle cell broken, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	control	Fig. 6 from Ramspacher et al., 2015
skeletal muscle cell alignment skeletal muscle cell, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	control	Fig. 6 from Ramspacher et al., 2015
heart contraction process quality, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	control	Fig. 6 from Ramspacher et al., 2015
swimming behavior process quality, ameliorated	desma^{ct122aGt/ct122aGt} + MO2-desma	control	Fig. 6 from Ramspacher et al., 2015
muscle cell vacuole increased amount, abnormal	WT + MO2-desma	standard conditions	Fig. 3 from Bührdel et al., 2015
trunk curved, abnormal	WT + MO2-desma	standard conditions	Fig. S4 from Bührdel et al., 2015
skeletal muscle refractivity, abnormal	WT + MO2-desma	standard conditions	Fig. 3 , Fig. S4 from Bührdel et al., 2015
whole organism decreased mobility, abnormal	WT + MO2-desma	standard conditions	Fig. 2 from Bührdel et al., 2015
pericardium edematous, abnormal	WT + MO2-desma	standard conditions	Fig. S4 from Bührdel et al., 2015
skeletal muscle sarcomere disorganized, abnormal	WT + MO2-desma	standard conditions	Fig. 3 from Bührdel et al., 2015
skeletal muscle nucleus circular, abnormal	WT + MO2-desma	standard conditions	Fig. 3 from Bührdel et al., 2015
thigmotaxis disrupted, abnormal	WT + MO2-desma	standard conditions	Fig. 2 from Bührdel et al., 2015
skeletal muscle mitochondrial crista decreased amount, abnormal	WT + MO2-desma	standard conditions	Fig. 3 from Bührdel et al., 2015
locomotion disrupted, abnormal	WT + MO2-desma	standard conditions	Fig. 2 from Bührdel et al., 2015

Citations