Morpholino

MO2-musk

ID

ZDB-MRPHLNO-091209-1

Name

MO2-musk

Previous Names

unplugged FL MO (1)

Target

musk (1)

Sequence

5' - GTAGAGGATTACCGTATTGCCGTTT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

targeted to the longest of the three musk transcripts

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO2-musk

Expressed Gene	Anatomy	Figures
chrna1	myotome acetylcholine-gated channel complex	Fig. 6 from M�ller et al., 2010 Fig. 1 from Jing et al., 2009

Phenotype

Phenotype resulting from MO2-musk

Phenotype	Fish	Figures
myotome neuromuscular junction decreased amount, abnormal	WT + MO2-musk	Fig. 6 from M�ller et al., 2010
neuromuscular junction development decreased occurrence, abnormal	WT + MO2-musk	Fig. 6 from M�ller et al., 2010
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal	WT + MO2-musk	Fig. 6 from M�ller et al., 2010

Phenotype of all Fish created by or utilizing MO2-musk

Phenotype	Fish	Conditions	Figures
neuromuscular junction development decreased occurrence, abnormal	WT + MO2-musk	standard conditions	Fig. 6 from M�ller et al., 2010
myotome neuromuscular junction decreased amount, abnormal	WT + MO2-musk	standard conditions	Fig. 6 from M�ller et al., 2010
skeletal muscle acetylcholine-gated channel clustering decreased occurrence, abnormal	WT + MO2-musk	standard conditions	Fig. 6 from M�ller et al., 2010
motor neuron axon branchiness, abnormal	slc24a5^b1/+ + MO2-musk	standard conditions	Fig. 3 from McMacken et al., 2018
myotome cholinergic synapse decreased amount, abnormal	slc24a5^b1/+ + MO2-musk	standard conditions	Fig. 3 from McMacken et al., 2018
motor neuron axon morphology, ameliorated	slc24a5^b1/+ + MO2-musk	chemical treatment by environment: forskolin	Fig. 5 from McMacken et al., 2018
motor neuron axon truncated, abnormal	slc24a5^b1/+ + MO2-musk	standard conditions	Fig. 3 from McMacken et al., 2018
motor neuron axon morphology, ameliorated	slc24a5^b1/+ + MO2-musk	chemical treatment by environment: albuterol	Fig. 3 from McMacken et al., 2018
motor neuron axon truncated, abnormal	slc24a5^b1/+ + MO2-musk	chemical treatment by environment: ICI 118551, chemical treatment by environment: albuterol	Fig. 4 from McMacken et al., 2018
myotome cholinergic synapse amount, ameliorated	slc24a5^b1/+ + MO2-musk	chemical treatment by environment: albuterol	Fig. 3 from McMacken et al., 2018
motor neuron axon branchiness, abnormal	slc24a5^b1/+ + MO2-musk	chemical treatment by environment: ICI 118551, chemical treatment by environment: albuterol	Fig. 4 from McMacken et al., 2018

Citations