Morpholino

MO1-adgrg6

ID
ZDB-MRPHLNO-090917-8
Name
MO1-adgrg6
Previous Names
None
Target
Sequence
5' - ACAGAATATGAATACCTGATACTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-adgrg6
Expressed Gene Anatomy Figures
adgrg6 Fig. S3 from Monk et al., 2009
egr2b Fig. S4 with image from Patra et al., 2013
Fig. S3 from Monk et al., 2009
kdrl Fig. 5 from Cui et al., 2014
mbpa Fig. S4 with image from Patra et al., 2013
Fig. 1 from Monk et al., 2009
Phenotype
Phenotype resulting from MO1-adgrg6
Phenotype Fish Figures
cell migration involved in sprouting angiogenesis decreased process quality, abnormal y1Tg + MO1-adgrg6 Fig. 4 from Cui et al., 2014
inner ear edematous, abnormal AB + MO1-adgrg6 Fig. S4 with image from Patra et al., 2013
inner ear increased size, abnormal AB + MO1-adgrg6 Fig. S4 with image from Patra et al., 2013
Fig. S3 from Monk et al., 2009
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal y7Tg + MO1-adgrg6 Fig. 4 from Cui et al., 2014
intersegmental vessel morphology, abnormal y1Tg + MO1-adgrg6 Fig. 4,  Fig. 7 from Cui et al., 2014
myelination of posterior lateral line nerve axons disrupted, abnormal AB + MO1-adgrg6 Fig. S4 with image from Patra et al., 2013
posterior lateral line nerve compact myelin absent, abnormal WT + MO1-adgrg6 Fig. S3 from Monk et al., 2009
posterior lateral line nerve myelin sheath morphology, abnormal WT + MO1-adgrg6 Fig. 1 from Monk et al., 2009
posterior lateral line nerve myelin sheath physical object quality, abnormal AB + MO1-adgrg6 Fig. S4 with image from Patra et al., 2013
sprouting angiogenesis decreased process quality, abnormal y1Tg + MO1-adgrg6 Fig. 4,  Fig. 7 from Cui et al., 2014
Phenotype of all Fish created by or utilizing MO1-adgrg6
Phenotype Fish Conditions Figures
myelination of posterior lateral line nerve axons disrupted, abnormal AB + MO1-adgrg6 standard conditions Fig. S4 with image from Patra et al., 2013
inner ear edematous, abnormal AB + MO1-adgrg6 standard conditions Fig. S4 with image from Patra et al., 2013
inner ear increased size, abnormal AB + MO1-adgrg6 standard conditions Fig. S4 with image from Patra et al., 2013
posterior lateral line nerve myelin sheath physical object quality, abnormal AB + MO1-adgrg6 standard conditions Fig. S4 with image from Patra et al., 2013
posterior lateral line nerve myelin sheath morphology, abnormal WT + MO1-adgrg6 standard conditions Fig. 1 from Monk et al., 2009
inner ear increased size, abnormal WT + MO1-adgrg6 standard conditions Fig. S3 from Monk et al., 2009
posterior lateral line nerve compact myelin absent, abnormal WT + MO1-adgrg6 standard conditions Fig. S3 from Monk et al., 2009
intersegmental vessel morphology, abnormal y1Tg + MO1-adgrg6 standard conditions Fig. 4,  Fig. 7 from Cui et al., 2014
sprouting angiogenesis decreased process quality, abnormal y1Tg + MO1-adgrg6 standard conditions Fig. 4,  Fig. 7 from Cui et al., 2014
cell migration involved in sprouting angiogenesis decreased process quality, abnormal y1Tg + MO1-adgrg6 standard conditions Fig. 4 from Cui et al., 2014
intersegmental vessel has fewer parts of type blood vessel endothelial cell, abnormal y7Tg + MO1-adgrg6 standard conditions Fig. 4 from Cui et al., 2014
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.