Morpholino

MO4-znf503

ID

ZDB-MRPHLNO-090724-4

Name

MO4-znf503

Previous Names

Nlz2SP (1)

Target

znf503 (1)

Sequence

5' - CATTCTTACCTCAATTGGACTGACC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-znf503

No data available

Phenotype

Phenotype resulting from MO4-znf503

No data available

Phenotype of all Fish created by or utilizing MO4-znf503

Phenotype	Fish	Conditions	Figures
presumptive rhombomere 5 egr2b expression increased distribution, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 1 from Labalette et al., 2015
presumptive rhombomere 3 egr2b expression increased distribution, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 1 , Fig. S5 from Labalette et al., 2015
rhombomere 4 egr2b expression mislocalised, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 5 egr2b expression increased distribution, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 3 egr2b expression increased distribution, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 3 egr2b expression increased amount, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 5 egr2b expression increased amount, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
hindbrain morphology, abnormal	WT + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 6 from Nakamura et al., 2008
presumptive rhombomere 3 egr2b expression increased distribution, abnormal	egr2b^fh227/fh227 + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 1 from Labalette et al., 2015
presumptive rhombomere 5 egr2b expression increased distribution, abnormal	egr2b^fh227/fh227 + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 1 from Labalette et al., 2015
presumptive rhombomere 4 GFP expression increased distribution, abnormal	zf1077Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 4 from Labalette et al., 2015
hindbrain morphology, abnormal	hnf1ba^hi2169Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 6 from Nakamura et al., 2008
rhombomere 5 aplastic, abnormal	hnf1ba^hi2169Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	standard conditions	Fig. 6 from Nakamura et al., 2008
rhombomere 4 egr2b expression mislocalised, abnormal	zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 2 egr2b expression mislocalised, abnormal	zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 3 egr2b expression increased amount, abnormal	zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 5 egr2b expression increased distribution, abnormal	zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 5 egr2b expression increased amount, abnormal	zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015
rhombomere 3 egr2b expression increased distribution, abnormal	zf1076Tg + MO3-znf503 + MO3-znf703 + MO4-znf503 + MO4-znf703	heat shock	Fig. 3 from Labalette et al., 2015

Citations