Morpholino

MO2-arl6ip1

ID
ZDB-MRPHLNO-090316-2
Name
MO2-arl6ip1
Previous Names
  • arl6ip-MO2 (1)
Target
Sequence
5' - GATGTTACTTGAGAGTTTAGGTTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-arl6ip1
No data available
Phenotype
Phenotype resulting from MO2-arl6ip1
Phenotype Fish Figures
camera-type eye development arrested, abnormal AB + MO2-arl6ip1 Fig. 2 with image,  text only from Huang et al., 2009
extension decreased length, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
text only from Huang et al., 2009
eye decreased size, abnormal AB + MO2-arl6ip1 Fig. 2 with image,  text only from Huang et al., 2009
eye morphology, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
gut morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
head decreased size, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
head flat, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
hindbrain morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
iridophore decreased amount, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
mandibular arch skeleton decreased size, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
melanocyte decreased amount, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
melanocyte migration disrupted, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
optic tectum morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
otic vesicle decreased size, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
pectoral fin morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
pericardium edematous, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
text only from Huang et al., 2009
pharyngeal arch 3-7 morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
pigment cell irregular spatial pattern, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
pigmentation disrupted, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
pneumatic duct morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
post-vent region decreased length, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
retina morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
solid lens vesicle decreased size, abnormal AB + MO2-arl6ip1 text only from Tu et al., 2012
swim bladder morphology, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
trunk deformed, abnormal AB + MO2-arl6ip1 text only from Huang et al., 2009
Phenotype of all Fish created by or utilizing MO2-arl6ip1
Phenotype Fish Conditions Figures
post-vent region decreased length, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
iridophore decreased amount, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
pharyngeal arch 3-7 morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
extension decreased length, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
text only from Huang et al., 2009
melanocyte migration disrupted, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
pectoral fin morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
head flat, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
pigmentation disrupted, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
pigment cell irregular spatial pattern, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
optic tectum morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
eye morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
pneumatic duct morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
eye decreased size, abnormal AB + MO2-arl6ip1 standard conditions Fig. 2 with image,  text only from Huang et al., 2009
solid lens vesicle decreased size, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
swim bladder morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
pericardium edematous, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
text only from Huang et al., 2009
trunk deformed, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
mandibular arch skeleton decreased size, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
head decreased size, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
retina morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
hindbrain morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
melanocyte decreased amount, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
gut morphology, abnormal AB + MO2-arl6ip1 standard conditions text only from Huang et al., 2009
camera-type eye development arrested, abnormal AB + MO2-arl6ip1 standard conditions Fig. 2 with image,  text only from Huang et al., 2009
otic vesicle decreased size, abnormal AB + MO2-arl6ip1 standard conditions text only from Tu et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.