Morpholino

MO2-sec13

ID
ZDB-MRPHLNO-090206-4
Name
MO2-sec13
Previous Names
None
Target
Sequence
5' - TTTGCTTATATCCCTCAACAACCTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
translation-blocker
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-sec13
No data available
Phenotype
Phenotype resulting from MO2-sec13
Phenotype Fish Figures
amacrine cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
Bruch's membrane aplastic, abnormal WT + MO2-sec13 Fig. 5 with image from Schmidt et al., 2013
cartilage development disrupted, abnormal WT + MO2-sec13 Fig. S3 from Townley et al., 2008
cell population proliferation decreased rate, abnormal WT + MO2-sec13 Fig. 2 with image from Schmidt et al., 2013
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-sec13 Fig. 7,  Fig. S3 from Townley et al., 2008
eye decreased size, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
Fig. 7,  Fig. S3 from Townley et al., 2008
eye cell apoptotic, abnormal WT + MO2-sec13 Fig. 2 with image from Schmidt et al., 2013
eye photoreceptor cell endoplasmic reticulum dilated, abnormal WT + MO2-sec13 Fig. 4 with image from Schmidt et al., 2013
fin kinked, abnormal WT + MO2-sec13 Fig. 2 with image from Schmidt et al., 2013
head decreased size, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
Fig. 7,  Fig. S3 from Townley et al., 2008
Meckel's cartilage malformed, abnormal WT + MO2-sec13 Fig. 7,  Fig. S3 from Townley et al., 2008
Muller cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
Muller cell disoriented, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
neurocranium malformed, abnormal WT + MO2-sec13 Fig. 7,  Fig. S3 from Townley et al., 2008
opsin transport disrupted, abnormal WT + MO2-sec13 Fig. 4 with image from Schmidt et al., 2013
pectoral fin kinked, abnormal WT + MO2-sec13 Fig. 7,  Fig. S3 from Townley et al., 2008
pectoral fin malformed, abnormal WT + MO2-sec13 Fig. S3 from Townley et al., 2008
photoreceptor cell morphology, abnormal WT + MO2-sec13 Fig. 4 with image from Schmidt et al., 2013
photoreceptor cell differentiation disrupted, abnormal WT + MO2-sec13 Fig. 1 with image,  Fig. 4 with image from Schmidt et al., 2013
photoreceptor outer segment layer absent, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
retina decreased size, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
retina disorganized, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
retina nucleus condensed, abnormal WT + MO2-sec13 Fig. 1 with image from Schmidt et al., 2013
retina layer formation disrupted, abnormal WT + MO2-sec13 Fig. 1 with image,  Fig. 2 with image,  Fig. 3 with image,  Fig. 5 with image from Schmidt et al., 2013
retinal cone cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
retinal ganglion cell decreased amount, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
retinal photoreceptor layer absent, abnormal WT + MO2-sec13 Fig. 1 with image,  Fig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium hypertrophic, abnormal WT + MO2-sec13 Fig. 1 with image,  Fig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium basement membrane aplastic, abnormal WT + MO2-sec13 Fig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium neuroepithelial cell disorganized, abnormal WT + MO2-sec13 Fig. 5 with image from Schmidt et al., 2013
retinal rod cell aplastic, abnormal WT + MO2-sec13 Fig. 3 with image from Schmidt et al., 2013
Phenotype of all Fish created by or utilizing MO2-sec13
Phenotype Fish Conditions Figures
embryonic cranial skeleton morphogenesis disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 7,  Fig. S3 from Townley et al., 2008
photoreceptor cell differentiation disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image,  Fig. 4 with image from Schmidt et al., 2013
Bruch's membrane aplastic, abnormal WT + MO2-sec13 standard conditions Fig. 5 with image from Schmidt et al., 2013
Meckel's cartilage malformed, abnormal WT + MO2-sec13 standard conditions Fig. 7,  Fig. S3 from Townley et al., 2008
Muller cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
neurocranium malformed, abnormal WT + MO2-sec13 standard conditions Fig. 7,  Fig. S3 from Townley et al., 2008
retina nucleus condensed, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
Muller cell disoriented, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
retinal ganglion cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
eye decreased size, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
Fig. 7,  Fig. S3 from Townley et al., 2008
pectoral fin kinked, abnormal WT + MO2-sec13 standard conditions Fig. 7,  Fig. S3 from Townley et al., 2008
retinal photoreceptor layer absent, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image,  Fig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium hypertrophic, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image,  Fig. 5 with image from Schmidt et al., 2013
retinal rod cell aplastic, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
head decreased size, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
Fig. 7,  Fig. S3 from Townley et al., 2008
cartilage development disrupted, abnormal WT + MO2-sec13 standard conditions Fig. S3 from Townley et al., 2008
retina disorganized, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
eye photoreceptor cell endoplasmic reticulum dilated, abnormal WT + MO2-sec13 standard conditions Fig. 4 with image from Schmidt et al., 2013
cell population proliferation decreased rate, abnormal WT + MO2-sec13 standard conditions Fig. 2 with image from Schmidt et al., 2013
opsin transport disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 4 with image from Schmidt et al., 2013
retinal pigmented epithelium basement membrane aplastic, abnormal WT + MO2-sec13 standard conditions Fig. 5 with image from Schmidt et al., 2013
amacrine cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
retinal cone cell decreased amount, abnormal WT + MO2-sec13 standard conditions Fig. 3 with image from Schmidt et al., 2013
pectoral fin malformed, abnormal WT + MO2-sec13 standard conditions Fig. S3 from Townley et al., 2008
retina layer formation disrupted, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image,  Fig. 3 with image,  Fig. 5 with image from Schmidt et al., 2013
retinal pigmented epithelium neuroepithelial cell disorganized, abnormal WT + MO2-sec13 standard conditions Fig. 5 with image from Schmidt et al., 2013
eye cell apoptotic, abnormal WT + MO2-sec13 standard conditions Fig. 2 with image from Schmidt et al., 2013
photoreceptor outer segment layer absent, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
fin kinked, abnormal WT + MO2-sec13 standard conditions Fig. 2 with image from Schmidt et al., 2013
retina decreased size, abnormal WT + MO2-sec13 standard conditions Fig. 1 with image from Schmidt et al., 2013
photoreceptor cell morphology, abnormal WT + MO2-sec13 standard conditions Fig. 4 with image from Schmidt et al., 2013
retina layer formation disrupted, abnormal WT + MO2-sec13 + MO4-tp53 standard conditions Fig. 2 with image from Schmidt et al., 2013
fin kinked, abnormal WT + MO2-sec13 + MO4-tp53 standard conditions Fig. 2 with image from Schmidt et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.