Morpholino

MO1-dpf3

ID
ZDB-MRPHLNO-090129-1
Name
MO1-dpf3
Previous Names
None
Target
Sequence
5' - GCTCATCACTCACCCTGCCTTTGTT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
directed against the exon4-intron4 boundary
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dpf3
Expressed Gene Anatomy Figures
actc1b Fig. 4 from Lange et al., 2008
hand2 Fig. 4 from Lange et al., 2008
lft2 Fig. 4 from Lange et al., 2008
myh6 Fig. 4 from Lange et al., 2008
myh7 Fig. 4 from Lange et al., 2008
pitx2 Fig. 4 from Lange et al., 2008
ptk2ab Fig. 4 from Lange et al., 2008
xirp1 Fig. 4 from Lange et al., 2008
Phenotype
Phenotype resulting from MO1-dpf3
Phenotype Fish Figures
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-dpf3 Fig. 4 from Lange et al., 2008
heart malformed, abnormal twu34Tg + MO1-dpf3 Fig. 4 from Lange et al., 2008
heart looping disrupted, abnormal twu34Tg + MO1-dpf3 Fig. 4 from Lange et al., 2008
heart morphogenesis disrupted, abnormal twu34Tg + MO1-dpf3 Fig. 4 from Lange et al., 2008
muscle organ morphogenesis disrupted, abnormal twu34Tg + MO1-dpf3 Fig. 4 from Lange et al., 2008
myotome malformed, abnormal WT + MO1-dpf3 Fig. 4 from Lange et al., 2008
myotome skeletal muscle cell disorganized, abnormal WT + MO1-dpf3 Fig. 4 from Lange et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-dpf3 Fig. 4 from Lange et al., 2008
sarcomere organization disrupted, abnormal WT + MO1-dpf3 Fig. 4 from Lange et al., 2008
skeletal muscle cell sarcomere disorganized, abnormal WT + MO1-dpf3 Fig. 4 from Lange et al., 2008
vertical myoseptum malformed, abnormal WT + MO1-dpf3 Fig. 4 from Lange et al., 2008
Phenotype of all Fish created by or utilizing MO1-dpf3
Phenotype Fish Conditions Figures
myotome skeletal muscle cell disorganized, abnormal WT + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
vertical myoseptum malformed, abnormal WT + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
skeletal muscle cell sarcomere disorganized, abnormal WT + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
myotome malformed, abnormal WT + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
sarcomere organization disrupted, abnormal WT + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
post-vent region curved dorsal, abnormal WT + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
cardiac muscle cell sarcomere disorganized, abnormal WT + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
heart looping disrupted, abnormal twu34Tg + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
heart morphogenesis disrupted, abnormal twu34Tg + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
heart malformed, abnormal twu34Tg + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
muscle organ morphogenesis disrupted, abnormal twu34Tg + MO1-dpf3 standard conditions Fig. 4 from Lange et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.