Morpholino

MO1-cacnb4b

ID

ZDB-MRPHLNO-090114-4

Name

MO1-cacnb4b

Previous Names

None

Target

Sequence

5' - TCTCTATCTGCTTACCCTTGTACTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-cacnb4b

No data available

Phenotype

Phenotype resulting from MO1-cacnb4b

Phenotype	Fish	Figures
central nervous system necrotic, abnormal	WIK + MO1-cacnb4b	Fig. 3 from Ebert et al., 2008
epiboly involved in gastrulation with mouth forming second arrested, abnormal	WIK + MO1-cacnb4b	Fig. 3 from Ebert et al., 2008
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	WIK + MO1-cacnb4b	Fig. 3 from Ebert et al., 2008
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	WIK + MO1-cacnb4b	Fig. 6 from Ebert et al., 2008
marginal blastomere necrotic, abnormal	WIK + MO1-cacnb4b	Fig. 3 from Ebert et al., 2008
whole organism dead, abnormal	WIK + MO1-cacnb4b	Fig. 3 from Ebert et al., 2008
whole organism malformed, abnormal	WIK + MO1-cacnb4b	Fig. 3 from Ebert et al., 2008
yolk syncytial layer nucleus aggregated, abnormal	WIK + MO1-cacnb4b	Fig. 6 from Ebert et al., 2008
yolk syncytial layer nucleus decreased size, abnormal	WIK + MO1-cacnb4b	Fig. 6 from Ebert et al., 2008
yolk syncytial layer nucleus dispersed, abnormal	WIK + MO1-cacnb4b	Fig. 6 from Ebert et al., 2008
yolk syncytial layer nucleus increased size, abnormal	WIK + MO1-cacnb4b	Fig. 6 from Ebert et al., 2008
yolk syncytial layer nucleus mislocalised, abnormal	WIK + MO1-cacnb4b	Fig. 6 from Ebert et al., 2008

Phenotype of all Fish created by or utilizing MO1-cacnb4b

Phenotype	Fish	Conditions	Figures
epiboly involved in gastrulation with mouth forming second disrupted, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 6 from Ebert et al., 2008
yolk syncytial layer nucleus decreased size, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 6 from Ebert et al., 2008
yolk syncytial layer nucleus aggregated, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 6 from Ebert et al., 2008
marginal blastomere necrotic, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 3 from Ebert et al., 2008
whole organism dead, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 3 from Ebert et al., 2008
yolk syncytial layer nucleus dispersed, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 6 from Ebert et al., 2008
epiboly involved in gastrulation with mouth forming second decreased rate, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 3 from Ebert et al., 2008
whole organism malformed, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 3 from Ebert et al., 2008
yolk syncytial layer nucleus mislocalised, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 6 from Ebert et al., 2008
yolk syncytial layer nucleus increased size, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 6 from Ebert et al., 2008
epiboly involved in gastrulation with mouth forming second arrested, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 3 from Ebert et al., 2008
central nervous system necrotic, abnormal	WIK + MO1-cacnb4b	standard conditions	Fig. 3 from Ebert et al., 2008

Citations