Morpholino

MO7-sox18

ID
ZDB-MRPHLNO-081022-6
Name
MO7-sox18
Previous Names
  • sox18-MO2 (1)
Target
Sequence
5' - GTGAGTGTCTTACCCAGCATTTTAC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
binds to intron splice site
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO7-sox18
Expressed Gene Anatomy Figures
cdh5 Fig. 6 from Cermenati et al., 2013
dab2 Fig. 6 from Cermenati et al., 2013
flt4 Fig. 6 from Cermenati et al., 2013
lyve1b Fig. 6 from Cermenati et al., 2013
sox7 Figure S6 from Moleri et al., 2023
Phenotype
Phenotype resulting from MO7-sox18
Phenotype Fish Figures
lymphangiogenesis disrupted, abnormal y171Tg; y251Tg + MO7-sox18 Figure S2 from Moleri et al., 2023
posterior cardinal vein vascular lymphangioblast absent, abnormal y1Tg + MO7-sox18 Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal y1Tg + MO7-sox18 Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO7-sox18 Fig. 2 from Cermenati et al., 2013
thoracic duct aplastic/hypoplastic, abnormal y1Tg + MO7-sox18 Fig. 1 from Cermenati et al., 2013
thoracic duct decreased amount, abnormal y171Tg; y251Tg + MO7-sox18 Figure S2 from Moleri et al., 2023
thoracic duct hypoplastic, abnormal y171Tg; y251Tg + MO7-sox18 Figure S2 from Moleri et al., 2023
thoracic duct malformed, abnormal y171Tg; y251Tg + MO7-sox18 Figure S2 from Moleri et al., 2023
thoracic duct morphology, abnormal y1Tg + MO7-sox18 Fig. 1 from Cermenati et al., 2013
vascular lymphangioblast decreased amount, abnormal y1Tg + MO7-sox18 Fig. 2 from Cermenati et al., 2013
Phenotype of all Fish created by or utilizing MO7-sox18
Phenotype Fish Conditions Figures
thoracic duct morphology, abnormal y1Tg + MO7-sox18 standard conditions Fig. 1 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal y1Tg + MO7-sox18 standard conditions Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO7-sox18 standard conditions Fig. 2 from Cermenati et al., 2013
vascular lymphangioblast decreased amount, abnormal y1Tg + MO7-sox18 standard conditions Fig. 2 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal y1Tg + MO7-sox18 standard conditions Fig. 6 from Cermenati et al., 2013
thoracic duct aplastic/hypoplastic, abnormal y1Tg + MO7-sox18 standard conditions Fig. 1 from Cermenati et al., 2013
thoracic duct hypoplastic, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
thoracic duct malformed, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
lymphangiogenesis disrupted, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
thoracic duct decreased amount, abnormal y171Tg; y251Tg + MO7-sox18 standard conditions Figure S2 from Moleri et al., 2023
horizontal myoseptum vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein intersegmental vein decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular sprouts decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
thoracic duct aplastic, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 4 from Cermenati et al., 2013
trunk intersegmental vein decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast decreased amount, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 5,  Fig. 6 from Cermenati et al., 2013
posterior cardinal vein vascular lymphangioblast absent, abnormal y1Tg + MO2-vegfc + MO7-sox18 standard conditions Fig. 6 from Cermenati et al., 2013
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.