Morpholino

MO1-foxg1a

ID

ZDB-MRPHLNO-080911-1

Name

MO1-foxg1a

Previous Names

Target

Sequence

5' - TCCCATATCCAACATCACAAGTAAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-foxg1a

Expressed Gene	Anatomy	Figures
calb2b	microvillous olfactory receptor neuron olfactory epithelium	Fig. 6, Fig. S5 from Duggan et al., 2008
cxcr4b	olfactory placode	Fig. 6 from Duggan et al., 2008
fgf8a	midbrain hindbrain boundary telencephalon	Fig. S5 from Duggan et al., 2008
ompb	ciliated olfactory receptor neuron olfactory epithelium	Fig. 6 from Duggan et al., 2008

Phenotype

Phenotype resulting from MO1-foxg1a

Phenotype	Fish	Figures
cell proliferation in forebrain disrupted, abnormal	TL + MO1-foxg1a	Fig. 6 from Duggan et al., 2008
ciliated olfactory receptor neuron decreased amount, abnormal	TL + MO1-foxg1a	Fig. 6 from Duggan et al., 2008
embryonic retina morphogenesis in camera-type eye decreased process quality, abnormal	WT + MO1-foxg1a	Fig. 6 from Picker et al., 2009
epithelial cell proliferation disrupted, abnormal	TL + MO1-foxg1a	Fig. 6, Fig. S5 from Duggan et al., 2008
microvillous olfactory receptor neuron decreased amount, abnormal	TL + MO1-foxg1a	Fig. 6, Fig. S5 from Duggan et al., 2008
olfactory bulb morphology, abnormal	TL + MO1-foxg1a	Fig. 6 from Duggan et al., 2008
optic vesicle malformed, abnormal	WT + MO1-foxg1a	Fig. 6 from Picker et al., 2009
peripheral olfactory organ morphology, abnormal	TL + MO1-foxg1a	Fig. 6 from Duggan et al., 2008

Phenotype of all Fish created by or utilizing MO1-foxg1a

Phenotype	Fish	Conditions	Figures
epithelial cell proliferation disrupted, abnormal	TL + MO1-foxg1a	standard conditions	Fig. 6, Fig. S5 from Duggan et al., 2008
microvillous olfactory receptor neuron decreased amount, abnormal	TL + MO1-foxg1a	standard conditions	Fig. 6, Fig. S5 from Duggan et al., 2008
peripheral olfactory organ morphology, abnormal	TL + MO1-foxg1a	standard conditions	Fig. 6 from Duggan et al., 2008
olfactory bulb morphology, abnormal	TL + MO1-foxg1a	standard conditions	Fig. 6 from Duggan et al., 2008
cell proliferation in forebrain disrupted, abnormal	TL + MO1-foxg1a	standard conditions	Fig. 6 from Duggan et al., 2008
ciliated olfactory receptor neuron decreased amount, abnormal	TL + MO1-foxg1a	standard conditions	Fig. 6 from Duggan et al., 2008
optic vesicle malformed, abnormal	WT + MO1-foxg1a	standard conditions	Fig. 6 from Picker et al., 2009
embryonic retina morphogenesis in camera-type eye decreased process quality, abnormal	WT + MO1-foxg1a	standard conditions	Fig. 6 from Picker et al., 2009

Citations