Morpholino

MO1-zeb2b

ID

ZDB-MRPHLNO-080717-5

Name

MO1-zeb2b

Previous Names

sip1b TBMO (1)

Target

zeb2b (1)

Sequence

5' - GATCAGCTCCCGCATTGATAAACGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-zeb2b

Expressed Gene	Anatomy	Figures
egr2b	presumptive rhombomere 3 presumptive rhombomere 5	Fig. 3 from Delalande et al., 2008
myod1	segmental plate somite	Fig. 3 from Delalande et al., 2008
pax2a	midbrain hindbrain boundary neural rod	Fig. 3 from Delalande et al., 2008

Phenotype

Phenotype resulting from MO1-zeb2b

Phenotype	Fish	Figures
brain morphology, abnormal	WT + MO1-zeb2b	text only from Delalande et al., 2008
central nervous system development disrupted, abnormal	WT + MO1-zeb2b	text only from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-zeb2b	Fig. 3 , text only from Delalande et al., 2008
dorsal/ventral pattern formation disrupted, abnormal	WT + MO1-zeb2b	text only from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-zeb2b	text only from Delalande et al., 2008
somite morphology, abnormal	WT + MO1-zeb2b	Fig. 3 from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal	WT + MO1-zeb2b	text only from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-zeb2b	Fig. 3 , text only from Delalande et al., 2008

Phenotype of all Fish created by or utilizing MO1-zeb2b

Phenotype	Fish	Conditions	Figures
somite morphology, abnormal	WT + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-zeb2b	standard conditions	Fig. 3 , text only from Delalande et al., 2008
brain morphology, abnormal	WT + MO1-zeb2b	standard conditions	text only from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal	WT + MO1-zeb2b	standard conditions	text only from Delalande et al., 2008
dorsal/ventral pattern formation disrupted, abnormal	WT + MO1-zeb2b	standard conditions	text only from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal	WT + MO1-zeb2b	standard conditions	text only from Delalande et al., 2008
central nervous system development disrupted, abnormal	WT + MO1-zeb2b	standard conditions	text only from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-zeb2b	standard conditions	Fig. 3 , text only from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008
somite morphology, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008
dorsal convergence disrupted, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal	WT + MO1-zeb2a + MO1-zeb2b	standard conditions	Fig. 3 from Delalande et al., 2008

Citations