Morpholino

MO2-zeb2a

ID
ZDB-MRPHLNO-080717-4
Name
MO2-zeb2a
Previous Names
  • sip1a SBMO (1)
Target
Sequence
5' - ACAGTTGATTGCCTACCGTTTTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
Splice-blocking morpholino corresponding to the exon4/exon5 junction.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-zeb2a
Phenotype
Phenotype resulting from MO2-zeb2a
Phenotype of all Fish created by or utilizing MO2-zeb2a
Phenotype Fish Conditions Figures
brain morphology, abnormal WT + MO2-zeb2a standard conditions Fig. 2 with image from Delalande et al., 2008
heart morphology, abnormal WT + MO2-zeb2a standard conditions Fig. 2 with imageFig. 3 with image from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal WT + MO2-zeb2a standard conditions Fig. 2 with imageFig. 3 with image from Delalande et al., 2008
central nervous system development disrupted, abnormal WT + MO2-zeb2a standard conditions Fig. 3 with image from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal WT + MO2-zeb2a standard conditions Fig. 2 with image from Delalande et al., 2008
somite morphology, abnormal WT + MO2-zeb2a standard conditions Fig. 3 with image from Delalande et al., 2008
neural crest formation disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 3 with image from Delalande et al., 2008
somite morphology, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 3 with image from Delalande et al., 2008
dorsal/ventral pattern formation disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with imageFig. 3 with image from Delalande et al., 2008
convergent extension involved in axis elongation disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with imageFig. 3 with image from Delalande et al., 2008
whole organism anterior-posterior axis decreased length, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with imageFig. 3 with image from Delalande et al., 2008
dorsal convergence disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 3 with image from Delalande et al., 2008
heart morphology, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
brain morphology, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
post-anal tail morphogenesis disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
whole organism anterior-posterior axis curved ventral, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
central nervous system development disrupted, abnormal WT + MO2-zeb2a + MO2-zeb2b standard conditions Fig. 2 with image from Delalande et al., 2008
Citations