Morpholino

MO4-hsp90aa1.1

ID
ZDB-MRPHLNO-080405-1
Name
MO4-hsp90aa1.1
Previous Names
  • MO4-hsp90a.1
Target
Sequence
5' - CGACTTCTCAGGCATCTTGCTGTGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO4-hsp90aa1.1
Expressed Gene Anatomy Figures
ahsa1a Fig. 4 from Xiao et al., 2022
ahsa1b Fig. 4 from Xiao et al., 2022
eef1a1l1 Fig. 5 with image from Du et al., 2008
hsp90aa1.1 Fig. 5 with image from Du et al., 2008
myhz2 Fig. 5 with image,  Fig. S9 with image from Du et al., 2008
myod1 Fig. S7 with image from Du et al., 2008
smyhc1 Fig. 5 with image,  Fig. S9 with image from Du et al., 2008
trim55a Fig. 5 from Li et al., 2019
trim63a Fig. 5 from Li et al., 2019
unc45b Fig. 5 with image from Du et al., 2008
Phenotype
Phenotype resulting from MO4-hsp90aa1.1
Phenotype Fish Figures
fast muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 Fig. S8 with image from Du et al., 2008
muscle contraction arrested, abnormal WT + MO4-hsp90aa1.1 Fig. S7 with image from Du et al., 2008
myotome M band disorganized, abnormal WT + MO4-hsp90aa1.1 Fig. 3 with image,  Fig. S8 with image from Du et al., 2008
myotome myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 Fig. S8 with image,  Fig. S10 with image from Du et al., 2008
myotome striated muscle thin filament decreased amount, abnormal WT + MO4-hsp90aa1.1 Fig. 3 with image from Du et al., 2008
myotome Z disc disorganized, abnormal WT + MO4-hsp90aa1.1 Fig. 3 with image from Du et al., 2008
pericardium edematous, abnormal WT + MO4-hsp90aa1.1 Fig. S7 with image from Du et al., 2008
sarcomerogenesis disrupted, abnormal WT + MO4-hsp90aa1.1 Fig. 3 with image from Du et al., 2008
skeletal muscle ahsa1a expression increased amount, abnormal WT + MO4-hsp90aa1.1 Fig. 4 from Xiao et al., 2022
skeletal muscle ahsa1b expression increased amount, abnormal WT + MO4-hsp90aa1.1 Fig. 4 from Xiao et al., 2022
skeletal muscle ahsa1b expression increased distribution, abnormal WT + MO4-hsp90aa1.1 Fig. 4 from Xiao et al., 2022
skeletal muscle ahsa1a expression increased distribution, abnormal WT + MO4-hsp90aa1.1 Fig. 4 from Xiao et al., 2022
skeletal muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 Fig. 3 with image from Du et al., 2008
skeletal myofibril assembly disrupted, abnormal WT + MO4-hsp90aa1.1 Fig. 3 with image,  Fig. S8 with image from Du et al., 2008
slow muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 Fig. S8 with image from Du et al., 2008
slow muscle cell sarcomere decreased amount, abnormal WT + MO4-hsp90aa1.1 Fig. 3 with image from Du et al., 2008
whole organism immobile, abnormal WT + MO4-hsp90aa1.1 Fig. S7 with image from Du et al., 2008
whole organism ahsa1b expression increased amount, abnormal WT + MO4-hsp90aa1.1 Fig. 4 from Xiao et al., 2022
whole organism ahsa1a expression increased amount, abnormal WT + MO4-hsp90aa1.1 Fig. 4 from Xiao et al., 2022
Phenotype of all Fish created by or utilizing MO4-hsp90aa1.1
Phenotype Fish Conditions Figures
whole organism immobile, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
pericardium edematous, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
myotome myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with image,  Fig. S10 with image from Du et al., 2008
slow muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with image from Du et al., 2008
muscle contraction arrested, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S7 with image from Du et al., 2008
skeletal muscle ahsa1b expression increased amount, abnormal WT + MO4-hsp90aa1.1 control Fig. 4 from Xiao et al., 2022
skeletal muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
skeletal muscle ahsa1b expression increased distribution, abnormal WT + MO4-hsp90aa1.1 control Fig. 4 from Xiao et al., 2022
sarcomerogenesis disrupted, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
myotome striated muscle thin filament decreased amount, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
whole organism ahsa1a expression increased amount, abnormal WT + MO4-hsp90aa1.1 control Fig. 4 from Xiao et al., 2022
skeletal myofibril assembly disrupted, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image,  Fig. S8 with image from Du et al., 2008
myotome M band disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image,  Fig. S8 with image from Du et al., 2008
slow muscle cell sarcomere decreased amount, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
skeletal muscle ahsa1a expression increased amount, abnormal WT + MO4-hsp90aa1.1 control Fig. 4 from Xiao et al., 2022
fast muscle cell myofibril disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. S8 with image from Du et al., 2008
myotome Z disc disorganized, abnormal WT + MO4-hsp90aa1.1 standard conditions Fig. 3 with image from Du et al., 2008
skeletal muscle ahsa1a expression increased distribution, abnormal WT + MO4-hsp90aa1.1 control Fig. 4 from Xiao et al., 2022
whole organism ahsa1b expression increased amount, abnormal WT + MO4-hsp90aa1.1 control Fig. 4 from Xiao et al., 2022
skeletal muscle cell EGFP expression spatial pattern, abnormal mb19Tg + MO4-hsp90aa1.1 standard conditions Fig. 6 from Li et al., 2019
skeletal muscle cell M band EGFP expression absent, abnormal mb19Tg + MO4-hsp90aa1.1 standard conditions Fig. 6 from Li et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.