Morpholino

MO1-st14a

ID
ZDB-MRPHLNO-071218-1
Name
MO1-st14a
Previous Names
None
Target
Sequence
5' - AACGCATTCCTCCATCCATAGGGTC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-st14a
Expressed Gene Anatomy Figures
lcp1 Fig. 7 with image from Carney et al., 2007
Phenotype
Phenotype resulting from MO1-st14a
No data available
Phenotype of all Fish created by or utilizing MO1-st14a
Phenotype Fish Conditions Figures
trunk epidermis ab1-rps6 labeling amount, ameliorated atp1b1am14/m14 + MO1-st14a hypotonic Fig 3 with image from Hatzold et al., 2023
caudal fin mmp9 expression amount, ameliorated atp1b1am14/m14 + MO1-st14a hypotonic Fig 3 with image from Hatzold et al., 2023
caudal fin cell division frequency, ameliorated atp1b1am14/m14 + MO1-st14a standard conditions Fig 3 with image from Hatzold et al., 2023
pericardium edematous, abnormal atp1b1am14/m14 + MO1-st14a hypotonic Fig 2 with image from Hatzold et al., 2023
pronephric duct ab1-atp1a1 labeling decreased amount, abnormal atp1b1am14/m14 + MO1-st14a hypotonic Fig 2 with image from Hatzold et al., 2023
epidermal basal stratum ab5-akt labeling amount, ameliorated atp1b1am14/m14 + MO1-st14a hypotonic Fig 3 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions amount, ameliorated atp1b1am14/m14 + MO1-st14a standard conditions Fig 1 with image from Hatzold et al., 2023
trunk epidermis ab1-krt labeling decreased amount, abnormal atp1b1am14/m14 + MO1-st14a hypotonic Fig 2 with image from Hatzold et al., 2023
pronephric duct ab1-atp1a1 labeling spatial pattern, abnormal atp1b1am14/m14 + MO1-st14a hypotonic Fig 2 with image from Hatzold et al., 2023
peridermal cell plasma membrane region ab1-llgl2 labeling spatial pattern, abnormal atp1b1am14/m14 + MO1-st14a hypotonic Fig 2 with image from Hatzold et al., 2023
trunk epidermis ab1-krt labeling spatial pattern, abnormal atp1b1am14/m14 + MO1-st14a hypotonic Fig 2 with image from Hatzold et al., 2023
trunk epidermis ab1-rps6 labeling spatial pattern, ameliorated atp1b1am14/m14 + MO1-st14a hypotonic Fig 3 with image from Hatzold et al., 2023
caudal fin mmp9 expression spatial pattern, ameliorated atp1b1am14/m14 + MO1-st14a hypotonic Fig 3 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions increased amount, abnormal clint1ahi1520Tg/hi1520Tg + MO1-st14a standard conditions Fig 1 with image from Hatzold et al., 2023
epidermis potentially cancerous lesions increased amount, abnormal epcamhi2151Tg/hi2151Tg + MO1-st14a standard conditions Fig 1 with image from Hatzold et al., 2023
caudal fin EGFP expression amount, ameliorated sh235Tg/sh235Tg + MO1-st14a + MO2-atp1b1a hypotonic Fig 3 with image from Hatzold et al., 2023
caudal fin EGFP expression spatial pattern, ameliorated sh235Tg/sh235Tg + MO1-st14a + MO2-atp1b1a hypotonic Fig 3 with image from Hatzold et al., 2023
caudal fin epidermal cell aggregated, ameliorated spint1afr26/fr26 + MO1-st14a control Fig. 1 from Armistead et al., 2020
epidermis potentially cancerous lesions amount, ameliorated spint1ahi2217Tg/hi2217Tg + MO1-st14a standard conditions Fig 1 with image from Hatzold et al., 2023
whole organism il1b expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
whole organism mmp9 expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
whole organism mmp13a expression amount, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 7 from Schepis et al., 2018
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a control Fig. 5 from Armistead et al., 2020
integument cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a standard conditions Fig. 2 with image from Schepis et al., 2018
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO2-itga3b control Fig. 5 from Armistead et al., 2020
caudal fin epidermal cell aggregated, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
epidermal basal stratum cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
peridermal cell protruding out of epidermis, ameliorated WT + MO1-spint1a + MO1-st14a + MO3-lama5 control Fig. 5 from Armistead et al., 2020
epithelial cell protruding out of epidermal superficial stratum, ameliorated cy22Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 3 with image from Schepis et al., 2018
epidermal superficial stratum cell population proliferation occurrence, ameliorated cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell-cell adhesion process quality, ameliorated la213Tg; mu271Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 4 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated la213Tg; mu271Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 4 with image from Schepis et al., 2018
peridermal cell EGFP expression spatial pattern, ameliorated atp1b1am14/m14; fr59Tg/fr59Tg + MO1-st14a hypotonic Fig 6 with image from Hatzold et al., 2023
keratinocyte EGFP expression spatial pattern, ameliorated atp1b1am14/m14; fr59Tg/fr59Tg + MO1-st14a hypotonic Fig 6 with image from Hatzold et al., 2023
epidermal superficial stratum cell population proliferation increased occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
epidermal basal stratum cell motility occurrence, ameliorated f2rl1.2sfc18b/sfc18b; cy34Tg + MO1-spint1a + MO1-st14a standard conditions Fig. 6 with image from Schepis et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.