Morpholino

MO1-wt1b

ID

ZDB-MRPHLNO-071107-3

Name

MO1-wt1b

Previous Names

wt1b-splice1-1 (1)

Target

wt1b (1)

Sequence

5' - GGATGGTTTTCTCACCCTGGTTGCG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-wt1b

Expressed Gene	Anatomy	Figures
mafba	(not) pronephric glomerulus	Fig. 5 from Dong et al., 2015
magi2a	(not) pronephric glomerulus	Fig. 5 from Dong et al., 2015
nphs1	pronephric glomerulus	Fig. 4 from Perner et al., 2007
nphs2	pronephric glomerulus	Fig. 5 from Dong et al., 2015 Fig. 4 from Perner et al., 2007

Phenotype

Phenotype resulting from MO1-wt1b

Phenotype	Fish	Figures
glomerulus development disrupted, abnormal	li1Tg + MO1-wt1b (AB/TU)	Fig. 3 from Perner et al., 2007
pericardium edematous, abnormal	AB/TU + MO1-wt1b	Fig. 1 from Perner et al., 2007
pronephric glomerulus nphs2 expression decreased amount, abnormal	WT + MO1-wt1b	Fig. 5 from Dong et al., 2015
pronephric tubule cystic, abnormal	li1Tg + MO1-wt1b (AB/TU)	Fig. 3 from Perner et al., 2007
pronephros development disrupted, abnormal	li1Tg + MO1-wt1b (AB/TU)	Fig. 3 from Perner et al., 2007
whole organism increased curvature, abnormal	AB/TU + MO1-wt1b	Fig. 1 , Fig. S2 from Perner et al., 2007

Phenotype of all Fish created by or utilizing MO1-wt1b

Phenotype	Fish	Conditions	Figures
pericardium edematous, abnormal	AB/TU + MO1-wt1b	standard conditions	Fig. 1 from Perner et al., 2007
whole organism increased curvature, abnormal	AB/TU + MO1-wt1b	standard conditions	Fig. 1 , Fig. S2 from Perner et al., 2007
pronephric glomerulus nphs2 expression decreased amount, abnormal	WT + MO1-wt1b	standard conditions	Fig. 5 from Dong et al., 2015
pronephros development disrupted, abnormal	li1Tg + MO1-wt1b (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007
glomerulus development disrupted, abnormal	li1Tg + MO1-wt1b (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007
pronephric tubule cystic, abnormal	li1Tg + MO1-wt1b (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007
yolk edematous, abnormal	AB/TU + MO1-wt1b + MO2-wt1a	standard conditions	Fig. S2 from Perner et al., 2007
whole organism increased curvature, abnormal	AB/TU + MO1-wt1b + MO2-wt1a	standard conditions	Fig. S2 from Perner et al., 2007
pronephric tubule aplastic, abnormal	li1Tg + MO1-wt1b + MO2-wt1a (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007
glomerulus development disrupted, abnormal	li1Tg + MO1-wt1b + MO2-wt1a (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007
pronephros development disrupted, abnormal	li1Tg + MO1-wt1b + MO2-wt1a (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007
pronephric glomerulus aplastic, abnormal	li1Tg + MO1-wt1b + MO2-wt1a (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007
pronephric duct malformed, abnormal	li1Tg + MO1-wt1b + MO2-wt1a (AB/TU)	standard conditions	Fig. 3 from Perner et al., 2007

Citations