Morpholino

MO2-wt1a

ID
ZDB-MRPHLNO-071107-1
Name
MO2-wt1a
Previous Names
  • wt1a-splice1-1 (1)
Target
Sequence
5' - AAAGTAGTTCCTCACCTTGATTCCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-wt1a
Expressed Gene Anatomy Figures
mafba Fig. 5 from Dong et al., 2015
magi2a Fig. 5 from Dong et al., 2015
nphs1 Fig. 4 with image from Schnerwitzki et al., 2014
Fig. 4 with image from Perner et al., 2007
nphs2 Fig. 5 from Dong et al., 2015
Fig. 4 with image from Perner et al., 2007
Phenotype
Phenotype resulting from MO2-wt1a
Phenotype Fish Figures
choroid plexus morphology, abnormal li1Tg + MO2-wt1a (AB/TU) FIGURE 4 with image from Hopfenmüller et al., 2022
choroid plexus ab1-cldn5 labeling spatial pattern, abnormal li1Tg + MO2-wt1a (AB/TU) FIGURE 4 with image from Hopfenmüller et al., 2022
choroid plexus structure, abnormal li1Tg + MO2-wt1a (AB/TU) FIGURE 4 with image from Hopfenmüller et al., 2022
glomerular filtration disrupted, abnormal EKW + MO2-wt1a Fig. 3 from Hall et al., 2015
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a (AB/TU) Fig. 4 with image from Schnerwitzki et al., 2014
Fig. 3 with image from Perner et al., 2007
pericardium edematous, abnormal AB/TU + MO2-wt1a Fig. 3 from Hall et al., 2015
Fig. 1 with image from Perner et al., 2007
podocyte podocyte foot flattened, abnormal EKW + MO2-wt1a Fig. 4 from Hall et al., 2015
podocyte podocyte foot morphology, abnormal EKW + MO2-wt1a Fig. 4 from Hall et al., 2015
podocyte differentiation disrupted, abnormal EKW + MO2-wt1a Fig. 4 from Hall et al., 2015
presumptive pronephric mesoderm malformed, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Schnerwitzki et al., 2014
pronephric glomerulus aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) Fig. 3 with image from Perner et al., 2007
pronephric glomerulus morphogenesis arrested, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Schnerwitzki et al., 2014
pronephric tubule aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) Fig. 3 with image from Perner et al., 2007
pronephros development disrupted, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Perner et al., 2016
somite EGFP expression mislocalised, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Perner et al., 2016
somite EGFP expression spatial pattern, abnormal li1Tg + MO2-wt1a Fig. 4 with image from Perner et al., 2016
whole organism edematous, abnormal AB/TU + MO2-wt1a Fig. 1 with image from Perner et al., 2007
yolk edematous, abnormal AB/TU + MO2-wt1a Fig. 1 with image,  Fig. S2 with image from Perner et al., 2007
yolk syncytial layer edematous, abnormal EKW + MO2-wt1a Fig. 3 from Hall et al., 2015
Phenotype of all Fish created by or utilizing MO2-wt1a
Phenotype Fish Conditions Figures
pericardium edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with image from Perner et al., 2007
yolk edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with image,  Fig. S2 with image from Perner et al., 2007
whole organism edematous, abnormal AB/TU + MO2-wt1a standard conditions Fig. 1 with image from Perner et al., 2007
yolk syncytial layer edematous, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte podocyte foot morphology, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
glomerular filtration disrupted, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte differentiation disrupted, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
pericardium edematous, abnormal EKW + MO2-wt1a standard conditions Fig. 3 from Hall et al., 2015
podocyte podocyte foot flattened, abnormal EKW + MO2-wt1a standard conditions Fig. 4 from Hall et al., 2015
pronephros development disrupted, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
somite EGFP expression spatial pattern, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
presumptive pronephric mesoderm malformed, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
pronephric glomerulus morphogenesis arrested, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
somite EGFP expression mislocalised, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Perner et al., 2016
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a standard conditions Fig. 4 with image from Schnerwitzki et al., 2014
pronephric glomerulus aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
choroid plexus structure, abnormal li1Tg + MO2-wt1a (AB/TU) control FIGURE 4 with image from Hopfenmüller et al., 2022
pronephric tubule aplastic, abnormal li1Tg + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
choroid plexus morphology, abnormal li1Tg + MO2-wt1a (AB/TU) control FIGURE 4 with image from Hopfenmüller et al., 2022
glomerulus development disrupted, abnormal li1Tg + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
choroid plexus ab1-cldn5 labeling spatial pattern, abnormal li1Tg + MO2-wt1a (AB/TU) control FIGURE 4 with image from Hopfenmüller et al., 2022
yolk edematous, abnormal AB/TU + MO1-wt1b + MO2-wt1a standard conditions Fig. S2 with image from Perner et al., 2007
whole organism increased curvature, abnormal AB/TU + MO1-wt1b + MO2-wt1a standard conditions Fig. S2 with image from Perner et al., 2007
pronephric tubule aplastic, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
glomerulus development disrupted, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephros development disrupted, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric glomerulus aplastic, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
pronephric duct malformed, abnormal li1Tg + MO1-wt1b + MO2-wt1a (AB/TU) standard conditions Fig. 3 with image from Perner et al., 2007
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.