Morpholino

MO8-tal1

ID

ZDB-MRPHLNO-070801-1

Name

MO8-tal1

Previous Names

None

Target

Sequence

5' - GCGGACTCAACTGCACCATTCGAGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO8-tal1

Expressed Gene	Anatomy	Figures
dlc	artery	Fig. S2 from Qian et al., 2007
gata1a	intermediate cell mass of mesoderm	Fig. 3 from Qian et al., 2007
hbbe1.1	intermediate cell mass of mesoderm	Fig. 3 from Qian et al., 2007
hey2	artery	Fig. S2 from Qian et al., 2007
myb	(not) ventral wall of dorsal aorta	Fig. 6 from Qian et al., 2007
rag1	(not) T cell	Fig. 6 from Qian et al., 2007
runx1	(not) ventral wall of dorsal aorta	Fig. 6 from Qian et al., 2007
spi1b	macrophage	Fig. 3 from Qian et al., 2007
tal1	posterior lateral mesoderm	Fig. 3 from Qian et al., 2007

Phenotype

Phenotype resulting from MO8-tal1

Phenotype	Fish	Figures
hemoglobin biosynthetic process disrupted, abnormal	WT + MO8-tal1	Fig. 4 from Qian et al., 2007
nucleate erythrocyte decreased amount, abnormal	WT + MO8-tal1	Fig. 4 from Qian et al., 2007
nucleate erythrocyte immature, abnormal	WT + MO8-tal1	Fig. 4 from Qian et al., 2007
ventral wall of dorsal aorta Citrine expression decreased amount, abnormal	ox1Tg + MO8-tal1	Fig. S1 from Bonkhofer et al., 2019
ventral wall of dorsal aorta lacks all parts of type hematopoietic stem cell, abnormal	la2Tg + MO8-tal1	Fig. 4 from Zhen et al., 2013
ventral wall of dorsal aorta endothelial cell apoptotic, abnormal	hkz07tTg; s843Tg + MO8-tal1	Fig. 4 from Zhen et al., 2013

Phenotype of all Fish created by or utilizing MO8-tal1

Phenotype	Fish	Conditions	Figures
nucleate erythrocyte immature, abnormal	WT + MO8-tal1	standard conditions	Fig. 4 from Qian et al., 2007
hemoglobin biosynthetic process disrupted, abnormal	WT + MO8-tal1	standard conditions	Fig. 4 from Qian et al., 2007
nucleate erythrocyte decreased amount, abnormal	WT + MO8-tal1	standard conditions	Fig. 4 from Qian et al., 2007
ventral wall of dorsal aorta lacks all parts of type hematopoietic stem cell, abnormal	la2Tg + MO8-tal1	standard conditions	Fig. 4 from Zhen et al., 2013
ventral wall of dorsal aorta Citrine expression decreased amount, abnormal	ox1Tg + MO8-tal1	standard conditions	Fig. S1 from Bonkhofer et al., 2019
ventral wall of dorsal aorta endothelial cell apoptotic, abnormal	hkz07tTg; s843Tg + MO8-tal1	standard conditions	Fig. 4 from Zhen et al., 2013

Citations