Morpholino

MO3-nkx2.2a

ID

ZDB-MRPHLNO-070622-3

Name

MO3-nkx2.2a

Previous Names

None

Target

Sequence

5' - TGGAGCATTTGATGCAGTCAAGTTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

against a part of the 52UTR common to both nkx2.2a mRNA variants and upstream of the start codon

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO3-nkx2.2a

Expressed Gene	Anatomy	Figures
gcga	pancreatic bud	Fig. 6 from Pauls et al., 2007
ghrl	pancreatic bud whole organism	Fig. 3 from Anderson et al., 2011 Fig. 6 from Pauls et al., 2007
ins	pancreatic B cell whole organism	Fig. 3 from Anderson et al., 2011 Fig. 6 from Pauls et al., 2007
sst2	pancreatic bud	Fig. 6 from Pauls et al., 2007
tm4sf4	pancreatic bud whole organism	Fig. 3 from Anderson et al., 2011

Phenotype

Phenotype resulting from MO3-nkx2.2a

Phenotype	Fish	Figures
endocrine pancreas physical object quality, abnormal	WT + MO3-nkx2.2a	Fig. 6 from Pauls et al., 2007
fourth ventricle increased size, abnormal	WT + MO3-nkx2.2a	Fig. S3 from Pauls et al., 2007
heart edematous, abnormal	WT + MO3-nkx2.2a	text only from Pauls et al., 2007
mandibular arch skeleton decreased size, abnormal	WT + MO3-nkx2.2a	text only from Pauls et al., 2007
pancreatic duct aplastic, abnormal	WT + MO3-nkx2.2a	Fig. 7 from Pauls et al., 2007
whole organism decreased length, abnormal	WT + MO3-nkx2.2a	text only from Pauls et al., 2007

Phenotype of all Fish created by or utilizing MO3-nkx2.2a

Phenotype	Fish	Conditions	Figures
heart edematous, abnormal	WT + MO2-nkx2.2a + MO3-nkx2.2a	standard conditions	text only from Pauls et al., 2007
mandibular arch skeleton decreased size, abnormal	WT + MO2-nkx2.2a + MO3-nkx2.2a	standard conditions	text only from Pauls et al., 2007
whole organism decreased length, abnormal	WT + MO2-nkx2.2a + MO3-nkx2.2a	standard conditions	text only from Pauls et al., 2007
fourth ventricle increased size, abnormal	WT + MO2-nkx2.2a + MO3-nkx2.2a	standard conditions	Fig. S3 from Pauls et al., 2007
pancreatic duct aplastic, abnormal	WT + MO3-nkx2.2a	standard conditions	Fig. 7 from Pauls et al., 2007
whole organism decreased length, abnormal	WT + MO3-nkx2.2a	standard conditions	text only from Pauls et al., 2007
fourth ventricle increased size, abnormal	WT + MO3-nkx2.2a	standard conditions	Fig. S3 from Pauls et al., 2007
mandibular arch skeleton decreased size, abnormal	WT + MO3-nkx2.2a	standard conditions	text only from Pauls et al., 2007
heart edematous, abnormal	WT + MO3-nkx2.2a	standard conditions	text only from Pauls et al., 2007
endocrine pancreas physical object quality, abnormal	WT + MO3-nkx2.2a	standard conditions	Fig. 6 from Pauls et al., 2007

Citations