Morpholino

MO2-obscnb

ID
ZDB-MRPHLNO-070122-1
Name
MO2-obscnb
Previous Names
None
Target
Sequence
5' - TGCTGCTTTCTTTCCCCCCTCAAAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-obscnb
No data available
Phenotype
Phenotype resulting from MO2-obscnb
Phenotype Fish Figures
cardiac muscle cell myofibril disorganized, abnormal EKW + MO2-obscnb Fig. 7 with image from Raeker et al., 2006
cardiac ventricle decreased size, abnormal EKW + MO2-obscnb Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
extracellular matrix organization process quality, abnormal WT + MO2-obscnb Fig. 3 from Raeker et al., 2011
heart decreased size, abnormal EKW + MO2-obscnb Fig. 4 with image from Raeker et al., 2006
heart structure, abnormal EKW + MO2-obscnb Fig. 7 with image from Raeker et al., 2006
heart contraction decreased rate, abnormal EKW + MO2-obscnb Fig. 7 with image from Raeker et al., 2006
horizontal myoseptum aplastic, abnormal EKW + MO2-obscnb Fig. 6 with image from Raeker et al., 2006
myoblast circular, abnormal WT + MO2-obscnb Fig. 2 from Raeker et al., 2011
myosin filament organization disrupted, abnormal WT + MO2-obscnb Fig. 4 from Raeker et al., 2011
myotome development disrupted, abnormal WT + MO2-obscnb Fig. 1 from Raeker et al., 2011
pericardium edematous, abnormal EKW + MO2-obscnb Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
post-vent region decreased length, abnormal WT + MO2-obscnb Fig. 1 from Raeker et al., 2011
skeletal muscle morphology, abnormal WT + MO2-obscnb Fig. 2 from Raeker et al., 2011
skeletal muscle dystrophin-associated glycoprotein complex morphology, abnormal WT + MO2-obscnb Fig. 7 from Raeker et al., 2011
skeletal muscle protein complex involved in cell adhesion morphology, abnormal WT + MO2-obscnb Fig. 6 from Raeker et al., 2011
skeletal muscle sarcolemma increased distance skeletal muscle skeletal muscle myofibril, abnormal WT + MO2-obscnb Fig. 8 from Raeker et al., 2011
skeletal muscle Z disc alignment skeletal muscle Z disc, abnormal WT + MO2-obscnb Fig. 9Fig. 10Fig. 11 from Raeker et al., 2011
skeletal muscle cell elongated, abnormal WT + MO2-obscnb Fig. 3 with image from Raeker et al., 2010
skeletal muscle cell myofibril disorganized, abnormal WT + MO2-obscnb Fig. 4 with image from Raeker et al., 2010
Fig. 5 with imageFig. 6 with image from Raeker et al., 2006
skeletal muscle cell myofibril orientation skeletal muscle cell, abnormal EKW + MO2-obscnb Fig. 5 with image from Raeker et al., 2006
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal EKW + MO2-obscnb Fig. 5 with image from Raeker et al., 2010
Fig. 5 with image from Raeker et al., 2006
skeletal muscle cell striated muscle myosin thick filament disorganized, abnormal EKW + MO2-obscnb Fig. 5 with image from Raeker et al., 2006
skeletal myofibril assembly delayed, abnormal WT + MO2-obscnb Fig. 5 from Raeker et al., 2011
skeletal myofibril assembly disrupted, abnormal WT + MO2-obscnb Fig. 4Fig. 8Fig. 9 from Raeker et al., 2011
somite border blurry, abnormal WT + MO2-obscnb Fig. 1Fig. 2 from Raeker et al., 2011
striated muscle cell development disrupted, abnormal EKW + MO2-obscnb Fig. 4 with image from Raeker et al., 2006
vertical myoseptum decreased size, abnormal EKW + MO2-obscnb Fig. 6 with image from Raeker et al., 2006
vertical myoseptum disorganized, abnormal WT + MO2-obscnb Fig. 3 with image from Raeker et al., 2010
vertical myoseptum morphology, abnormal EKW + MO2-obscnb Fig. 4 with image from Raeker et al., 2006
whole organism decreased length, abnormal EKW + MO2-obscnb Fig. 4 with image from Raeker et al., 2006
Phenotype of all Fish created by or utilizing MO2-obscnb
Phenotype Fish Conditions Figures
skeletal muscle cell myofibril disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with imageFig. 6 with image from Raeker et al., 2006
striated muscle cell development disrupted, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
pericardium edematous, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
heart structure, abnormal EKW + MO2-obscnb standard conditions Fig. 7 with image from Raeker et al., 2006
cardiac ventricle decreased size, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with imageFig. 7 with image from Raeker et al., 2006
heart contraction decreased rate, abnormal EKW + MO2-obscnb standard conditions Fig. 7 with image from Raeker et al., 2006
vertical myoseptum decreased size, abnormal EKW + MO2-obscnb standard conditions Fig. 6 with image from Raeker et al., 2006
cardiac muscle cell myofibril disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 7 with image from Raeker et al., 2006
whole organism decreased length, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2006
skeletal muscle cell striated muscle myosin thick filament disorganized, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2006
horizontal myoseptum aplastic, abnormal EKW + MO2-obscnb standard conditions Fig. 6 with image from Raeker et al., 2006
skeletal muscle cell myofibril orientation skeletal muscle cell, abnormal EKW + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2006
heart decreased size, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
vertical myoseptum morphology, abnormal EKW + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2006
skeletal myofibril assembly delayed, abnormal WT + MO2-obscnb standard conditions Fig. 5 from Raeker et al., 2011
myosin filament organization disrupted, abnormal WT + MO2-obscnb standard conditions Fig. 4 from Raeker et al., 2011
post-vent region decreased length, abnormal WT + MO2-obscnb standard conditions Fig. 1 from Raeker et al., 2011
skeletal muscle cell sarcoplasmic reticulum disorganized, abnormal WT + MO2-obscnb standard conditions Fig. 5 with image from Raeker et al., 2010
skeletal muscle sarcolemma increased distance skeletal muscle skeletal muscle myofibril, abnormal WT + MO2-obscnb standard conditions Fig. 8 from Raeker et al., 2011
myoblast circular, abnormal WT + MO2-obscnb standard conditions Fig. 2 from Raeker et al., 2011
skeletal muscle Z disc alignment skeletal muscle Z disc, abnormal WT + MO2-obscnb standard conditions Fig. 9Fig. 10Fig. 11 from Raeker et al., 2011
skeletal muscle morphology, abnormal WT + MO2-obscnb standard conditions Fig. 2 from Raeker et al., 2011
somite border blurry, abnormal WT + MO2-obscnb standard conditions Fig. 1Fig. 2 from Raeker et al., 2011
myotome development disrupted, abnormal WT + MO2-obscnb standard conditions Fig. 1 from Raeker et al., 2011
skeletal muscle protein complex involved in cell adhesion morphology, abnormal WT + MO2-obscnb standard conditions Fig. 6 from Raeker et al., 2011
vertical myoseptum disorganized, abnormal WT + MO2-obscnb standard conditions Fig. 3 with image from Raeker et al., 2010
skeletal muscle cell myofibril disorganized, abnormal WT + MO2-obscnb standard conditions Fig. 4 with image from Raeker et al., 2010
skeletal muscle dystrophin-associated glycoprotein complex morphology, abnormal WT + MO2-obscnb standard conditions Fig. 7 from Raeker et al., 2011
skeletal myofibril assembly disrupted, abnormal WT + MO2-obscnb standard conditions Fig. 4Fig. 8Fig. 9 from Raeker et al., 2011
extracellular matrix organization process quality, abnormal WT + MO2-obscnb standard conditions Fig. 3 from Raeker et al., 2011
skeletal muscle cell elongated, abnormal WT + MO2-obscnb standard conditions Fig. 3 with image from Raeker et al., 2010
Citations