Morpholino

MO1-igf1rb

ID

ZDB-MRPHLNO-061130-5

Name

MO1-igf1rb

Previous Names

None

Target

igf1rb (1)

Sequence

5' - TGTTTGCTAGACCTCATTCCTGTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO1-igf1rb

No data available

Phenotype

Phenotype resulting from MO1-igf1rb

Phenotype	Fish	Figures
embryo development delayed, abnormal	WT + MO1-igf1rb	Fig. 3 from Schlueter et al., 2006
whole organism decreased size, abnormal	WT + MO1-igf1rb	Fig. 3 from Schlueter et al., 2006

Phenotype of all Fish created by or utilizing MO1-igf1rb

Phenotype	Fish	Conditions	Figures
embryo development delayed, abnormal	WT + MO1-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2006
fin regeneration decreased process quality, abnormal	WT + MO1-igf1rb	physical alteration: anatomical structure	Fig. 3 from Chablais et al., 2010
fin regeneration arrested, abnormal	WT + MO1-igf1rb	physical alteration: anatomical structure	Fig. 3 from Chablais et al., 2010
whole organism decreased size, abnormal	WT + MO1-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2006
germ cell migration disrupted, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2007
somite decreased amount, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2006
inner ear hair cell absent, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
muscle contraction arrested, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 5 from Schlueter et al., 2006
lateral crista primordium aplastic, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
primordial germ cell decreased amount, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 1 from Schlueter et al., 2007
posterior crista primordium aplastic, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
whole organism decreased length, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2006
anterior crista primordium aplastic, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
retinal ganglion cell absent, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
slow muscle cell decreased amount, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 5 from Schlueter et al., 2006
whole organism dead, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	text only from Schlueter et al., 2006
fast muscle cell decreased amount, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 5 from Schlueter et al., 2006
heart morphogenesis delayed, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
cardiac ventricle structure, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
heart contraction decreased rate, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
heart decreased size, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
embryo development delayed, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2006
CaP motoneuron axon decreased functionality, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 5 from Schlueter et al., 2006
eye development disrupted, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
primordial germ cell misrouted, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2007
ear development disrupted, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
cardiac ventricle hypoplastic, abnormal	WT + MO1-igf1rb + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2006
fin regeneration arrested, abnormal	WT + MO1-igf1ra + MO1-igf1rb	physical alteration: anatomical structure	Fig. 3 from Chablais et al., 2010
fin regeneration decreased process quality, abnormal	WT + MO1-igf1ra + MO1-igf1rb	physical alteration: anatomical structure	Fig. 3 from Chablais et al., 2010
spinal cord apoptotic, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2007
eye aplastic, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 1 from Schlueter et al., 2007
cardiac ventricle decreased size, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 1 from Schlueter et al., 2007
heart primordium left side unfused from heart primordium right side, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 1 from Schlueter et al., 2007
brain apoptotic, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2007
somite decreased amount, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. Text from Schlueter et al., 2007 Fig. 3 from Schlueter et al., 2006
heart malformed, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 1 from Schlueter et al., 2007
primordial germ cell decreased amount, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 1 from Schlueter et al., 2007
CaP motoneuron decreased amount, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 4 from Schlueter et al., 2007
whole organism decreased length, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2006
whole organism dead, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. Text from Schlueter et al., 2007 text only from Schlueter et al., 2006
embryo development delayed, abnormal	WT + MO1-igf1ra + MO1-igf1rb + MO2-igf1ra + MO2-igf1rb	standard conditions	Fig. 3 from Schlueter et al., 2006

Citations