Morpholino

MO1-foxc1b

ID
ZDB-MRPHLNO-061111-3
Name
MO1-foxc1b
Previous Names
None
Target
Sequence
5' - GCATCGTACCCCTTTCTTCGGTACA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-foxc1b
No data available
Phenotype
Phenotype resulting from MO1-foxc1b
Phenotype Fish Figures
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b Fig. 4 with image from De Val et al., 2008
blood vessel morphogenesis disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b Fig. 4 with image from De Val et al., 2008
Phenotype of all Fish created by or utilizing MO1-foxc1b
Phenotype Fish Conditions Figures
blood vessel morphogenesis disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b standard conditions Fig. 4 with image from De Val et al., 2008
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b standard conditions Fig. 4 with image from De Val et al., 2008
retina layer formation delayed, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
brain vasculature morphology, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. S2 from French et al., 2014
lens development in camera-type eye delayed, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
pericardium edematous, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
periocular mesenchyme disorganized, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2,  Fig. 8 from Skarie et al., 2009
blood circulation disrupted, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2 from Skarie et al., 2009
hyaloid vessel decreased amount, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye decreased size, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2,  Fig. 3 from Skarie et al., 2009
corneal stroma structure, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2,  Fig. 8 from Skarie et al., 2009
eye basement membrane disorganized, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 6 from Skarie et al., 2009
eye hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 7 from Acharya et al., 2011
eye apoptotic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 7 from Berry et al., 2008
hyaloid vessel dilated, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
ventricular system distended, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye basement membrane morphology, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 7 from Skarie et al., 2009
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 7 from Acharya et al., 2011
whole organism decreased length, abnormal WT + MO1-foxc1b + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 7 from Acharya et al., 2011
neural crest cell migration delayed, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. S4 from French et al., 2014
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 1,  Fig. 2 from French et al., 2014
hyaloid vessel morphology, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 6 from Skarie et al., 2009
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 2,  Fig. 8 from Skarie et al., 2009
corneal endothelium aplastic, abnormal WT + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal sd2Tg/+ + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
eye hemorrhagic, abnormal sd2Tg/+ + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
central nervous system hemorrhagic, abnormal WT + MO1-foxc1b + MO1-pawr + MO2-foxc1a chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO1-pdgfrb + MO2-foxc1a standard conditions Fig. 2 from French et al., 2014
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO2-pdgfra standard conditions Fig. 2 from French et al., 2014
central nervous system hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1 standard conditions Fig. 8 from Skarie et al., 2009
eye hemorrhagic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1 standard conditions Fig. 8 from Skarie et al., 2009
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO5-lama1 standard conditions Fig. 8 from Skarie et al., 2009
whole organism decreased length, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hydrocephalic, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
pericardium edematous, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain decreased size, abnormal WT + MO1-foxc1b + MO2-foxc1a + MO7-pitx2 chemical treatment: N-phenylthiourea Fig. 8 from Acharya et al., 2011
brain hemorrhagic, abnormal WT + MO1-foxc1b + MO1-pdgfrb + MO2-foxc1a + MO2-pdgfra standard conditions Fig. 2 from French et al., 2014
pronephric glomerulus physical object quality, abnormal ki1Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
heart edematous, abnormal ki1Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from He et al., 2014
dorsal aorta morphology, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
intersegmental vessel increased branchiness, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 5 from Skarie et al., 2009
hyaloid vessel blood vessel endothelial cell disorganized, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
cardinal system morphology, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
vasculature broken, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
blood vessel endothelial cell disorganized, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 5 from Skarie et al., 2009
central nervous system hemorrhagic, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4,  Fig. 5 from Skarie et al., 2009
hyaloid vessel dilated, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
eye hemorrhagic, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4,  Fig. 5 from Skarie et al., 2009
hyaloid vessel branchiness, abnormal y5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 from Skarie et al., 2009
neural crest cell migration disrupted, abnormal zf15Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
eye decreased size, abnormal zf15Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from Skarie et al., 2009
cerebellum vascular associated smooth muscle cell decreased amount, abnormal ca7Tg; ci5Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from French et al., 2014
brain vasculature neural crest cell decreased amount, abnormal ci5Tg; zf566Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 3 from French et al., 2014
axial vasculature decreased size, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
intersegmental vessel aplastic, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
blood circulation disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
vasculature development disrupted, abnormal s843Tg; sd2Tg + MO1-foxc1b + MO2-foxc1a standard conditions Fig. 4 with image from De Val et al., 2008
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.