Morpholino

MO2-spast

ID
ZDB-MRPHLNO-061004-2
Name
MO2-spast
Previous Names
  • spg4exon7 (1)
Target
Sequence
5' - GATGTGAAAACAGACCTCTGGACGT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-spast
No data available
Phenotype
Phenotype resulting from MO2-spast
Phenotype Fish Figures
axon extension decreased occurrence, abnormal WT + MO2-spast + MO4-tp53 Fig. 2 with image from Butler et al., 2010
caudal fin morphology, abnormal AB + MO2-spast Fig. 6 from Zhang et al., 2012
cytoplasmic microtubule organization process quality, abnormal WT + MO2-spast Fig. 3 with image from Butler et al., 2010
extension morphology, abnormal AB + MO2-spast Fig. 6 from Zhang et al., 2012
head morphology, abnormal AB + MO2-spast Fig. 6 from Zhang et al., 2012
microtubule severing decreased occurrence, abnormal WT + MO2-spast Fig. 3 with image from Butler et al., 2010
motor neuron axon decreased length, abnormal WT + MO2-spast + MO4-tp53 Fig. 2 with image from Butler et al., 2010
primary motor neuron axon morphology, abnormal AB + MO2-spast Fig. 6 from Zhang et al., 2012
primary motor neuron axonogenesis process quality, abnormal AB + MO2-spast Fig. 6 from Zhang et al., 2012
Phenotype of all Fish created by or utilizing MO2-spast
Phenotype Fish Conditions Figures
primary motor neuron axon morphology, abnormal AB + MO2-spast control Fig. 6 from Zhang et al., 2012
primary motor neuron axonogenesis process quality, abnormal AB + MO2-spast control Fig. 6 from Zhang et al., 2012
head morphology, abnormal AB + MO2-spast control Fig. 6 from Zhang et al., 2012
caudal fin morphology, abnormal AB + MO2-spast control Fig. 6 from Zhang et al., 2012
extension morphology, abnormal AB + MO2-spast control Fig. 6 from Zhang et al., 2012
microtubule severing decreased occurrence, abnormal WT + MO2-spast standard conditions Fig. 3 with image from Butler et al., 2010
cytoplasmic microtubule organization process quality, abnormal WT + MO2-spast standard conditions Fig. 3 with image from Butler et al., 2010
motor neuron axon decreased length, abnormal WT + MO2-spast + MO4-tp53 standard conditions Fig. 2 with image from Butler et al., 2010
axon extension decreased occurrence, abnormal WT + MO2-spast + MO4-tp53 standard conditions Fig. 2 with image from Butler et al., 2010
primary motor neuron axon morphology, abnormal AB + MO1-zfyve27 + MO2-spast control Fig. 6 from Zhang et al., 2012
head morphology, abnormal AB + MO1-zfyve27 + MO2-spast control Fig. 6 from Zhang et al., 2012
primary motor neuron axonogenesis process quality, abnormal AB + MO1-zfyve27 + MO2-spast control Fig. 6 from Zhang et al., 2012
caudal fin morphology, abnormal AB + MO1-zfyve27 + MO2-spast control Fig. 6 from Zhang et al., 2012
extension morphology, abnormal AB + MO1-zfyve27 + MO2-spast control Fig. 6 from Zhang et al., 2012
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.